Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638874_at:

>probe:Drosophila_2:1638874_at:418:383; Interrogation_Position=1168; Antisense; GAACGTGATCAGCTTCACGGGCCAG
>probe:Drosophila_2:1638874_at:652:329; Interrogation_Position=1211; Antisense; GCGTGGAATCGCTACATTGCCGTCT
>probe:Drosophila_2:1638874_at:445:139; Interrogation_Position=1260; Antisense; ACGTGAGCGGCAACCAGTCGCATTG
>probe:Drosophila_2:1638874_at:502:501; Interrogation_Position=1276; Antisense; GTCGCATTGCCAGGATTACGTGTTC
>probe:Drosophila_2:1638874_at:596:705; Interrogation_Position=1291; Antisense; TTACGTGTTCAAGTCGACCTGGTTC
>probe:Drosophila_2:1638874_at:177:441; Interrogation_Position=1330; Antisense; GATGTGGCGCATCGTCAACGTGCAC
>probe:Drosophila_2:1638874_at:281:347; Interrogation_Position=1380; Antisense; GCATCTTCTGCGACAAGCTGTGGGA
>probe:Drosophila_2:1638874_at:701:629; Interrogation_Position=1419; Antisense; TCCGGTACAGCGGTTACATTATCCT
>probe:Drosophila_2:1638874_at:188:285; Interrogation_Position=1478; Antisense; CTGGAGGCCCAGAACTACATTTTCA
>probe:Drosophila_2:1638874_at:582:667; Interrogation_Position=1493; Antisense; TACATTTTCAACTCTACGGCGTGCA
>probe:Drosophila_2:1638874_at:232:33; Interrogation_Position=1581; Antisense; ATCAGCGATGCCTTTTTTAATTGTG
>probe:Drosophila_2:1638874_at:510:345; Interrogation_Position=1665; Antisense; GCATTTTGTCATTCAAGCGCGGTCT
>probe:Drosophila_2:1638874_at:488:205; Interrogation_Position=1679; Antisense; AAGCGCGGTCTGCAAGAGCAATCGA
>probe:Drosophila_2:1638874_at:436:361; Interrogation_Position=1696; Antisense; GCAATCGAAACTCCTTCAGCTGTAA

Paste this into a BLAST search page for me
GAACGTGATCAGCTTCACGGGCCAGGCGTGGAATCGCTACATTGCCGTCTACGTGAGCGGCAACCAGTCGCATTGGTCGCATTGCCAGGATTACGTGTTCTTACGTGTTCAAGTCGACCTGGTTCGATGTGGCGCATCGTCAACGTGCACGCATCTTCTGCGACAAGCTGTGGGATCCGGTACAGCGGTTACATTATCCTCTGGAGGCCCAGAACTACATTTTCATACATTTTCAACTCTACGGCGTGCAATCAGCGATGCCTTTTTTAATTGTGGCATTTTGTCATTCAAGCGCGGTCTAAGCGCGGTCTGCAAGAGCAATCGAGCAATCGAAACTCCTTCAGCTGTAA

Full Affymetrix probeset data:

Annotations for 1638874_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime