FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638876_at:

>probe:Drosophila_2:1638876_at:333:439; Interrogation_Position=2939; Antisense; GAGGCAGCTGGCACCAGCAGCGAAA
>probe:Drosophila_2:1638876_at:589:371; Interrogation_Position=2998; Antisense; GAAGGAGCCAGAGCCGACCTCCGAA
>probe:Drosophila_2:1638876_at:553:717; Interrogation_Position=3048; Antisense; TTCGCCAGCAACTGAAGGTCCTTAG
>probe:Drosophila_2:1638876_at:399:79; Interrogation_Position=3063; Antisense; AGGTCCTTAGCGTTATTGATGGCCA
>probe:Drosophila_2:1638876_at:79:69; Interrogation_Position=3081; Antisense; ATGGCCAGTCGTATGAGCCGCTGAA
>probe:Drosophila_2:1638876_at:602:415; Interrogation_Position=3095; Antisense; GAGCCGCTGAAGGATGTCACTATCG
>probe:Drosophila_2:1638876_at:35:365; Interrogation_Position=3123; Antisense; GAATTATTGTATTCCAGCACACTGG
>probe:Drosophila_2:1638876_at:72:415; Interrogation_Position=3158; Antisense; GACCAGGAGCTCGTTGAGCCAGTTG
>probe:Drosophila_2:1638876_at:132:267; Interrogation_Position=3177; Antisense; CAGTTGCCGCATTTGGACCGATGAA
>probe:Drosophila_2:1638876_at:720:299; Interrogation_Position=3226; Antisense; CCCAGAGCCCTTTGAGTACATCGAG
>probe:Drosophila_2:1638876_at:188:65; Interrogation_Position=3257; Antisense; ATGGGCATGCTGTTTGTCATTATCT
>probe:Drosophila_2:1638876_at:467:497; Interrogation_Position=3272; Antisense; GTCATTATCTAAGTGAATCCTGTTC
>probe:Drosophila_2:1638876_at:352:47; Interrogation_Position=3288; Antisense; ATCCTGTTCGATTTTCAACCTTGCT
>probe:Drosophila_2:1638876_at:494:251; Interrogation_Position=3303; Antisense; CAACCTTGCTTACGTTTCATGAGAA

Paste this into a BLAST search page for me
GAGGCAGCTGGCACCAGCAGCGAAAGAAGGAGCCAGAGCCGACCTCCGAATTCGCCAGCAACTGAAGGTCCTTAGAGGTCCTTAGCGTTATTGATGGCCAATGGCCAGTCGTATGAGCCGCTGAAGAGCCGCTGAAGGATGTCACTATCGGAATTATTGTATTCCAGCACACTGGGACCAGGAGCTCGTTGAGCCAGTTGCAGTTGCCGCATTTGGACCGATGAACCCAGAGCCCTTTGAGTACATCGAGATGGGCATGCTGTTTGTCATTATCTGTCATTATCTAAGTGAATCCTGTTCATCCTGTTCGATTTTCAACCTTGCTCAACCTTGCTTACGTTTCATGAGAA

Full Affymetrix probeset data:

Annotations for 1638876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720