FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638877_at:

>probe:Drosophila_2:1638877_at:540:149; Interrogation_Position=1782; Antisense; ACTTCCGGCTCTTCTGAGGGCCAAA
>probe:Drosophila_2:1638877_at:651:433; Interrogation_Position=1797; Antisense; GAGGGCCAAACTGCTTGCTGGCAAC
>probe:Drosophila_2:1638877_at:193:553; Interrogation_Position=1872; Antisense; GGAGCAATCCGGTATCTTTGTGATC
>probe:Drosophila_2:1638877_at:10:433; Interrogation_Position=1908; Antisense; GAGTCCCGGCTCAAATGGGCACAAG
>probe:Drosophila_2:1638877_at:160:595; Interrogation_Position=1923; Antisense; TGGGCACAAGCCTAAGTATCGAAAG
>probe:Drosophila_2:1638877_at:484:169; Interrogation_Position=1944; Antisense; AAAGGGCACGGCATTCACTCGGAGT
>probe:Drosophila_2:1638877_at:594:107; Interrogation_Position=1976; Antisense; AGAAGAGCCGATCCTGCAACTGTAG
>probe:Drosophila_2:1638877_at:361:357; Interrogation_Position=1991; Antisense; GCAACTGTAGCTCCATCGCTAAGGG
>probe:Drosophila_2:1638877_at:597:135; Interrogation_Position=2027; Antisense; ACGACGAGCCCAGCAGTAATCTCTG
>probe:Drosophila_2:1638877_at:37:83; Interrogation_Position=2053; Antisense; AGGGATCAGGAGTCCTCTGTACTTC
>probe:Drosophila_2:1638877_at:342:385; Interrogation_Position=2112; Antisense; GAACTTTTTTAGTCCGCTGAGATCG
>probe:Drosophila_2:1638877_at:699:517; Interrogation_Position=2137; Antisense; GTGGGCAGTTTCATGCAGCATTCCA
>probe:Drosophila_2:1638877_at:19:617; Interrogation_Position=2150; Antisense; TGCAGCATTCCAACTTGTTTCACTT
>probe:Drosophila_2:1638877_at:148:367; Interrogation_Position=2272; Antisense; GAATCGGTTCCAGTGGGTCTGACCA

Paste this into a BLAST search page for me
ACTTCCGGCTCTTCTGAGGGCCAAAGAGGGCCAAACTGCTTGCTGGCAACGGAGCAATCCGGTATCTTTGTGATCGAGTCCCGGCTCAAATGGGCACAAGTGGGCACAAGCCTAAGTATCGAAAGAAAGGGCACGGCATTCACTCGGAGTAGAAGAGCCGATCCTGCAACTGTAGGCAACTGTAGCTCCATCGCTAAGGGACGACGAGCCCAGCAGTAATCTCTGAGGGATCAGGAGTCCTCTGTACTTCGAACTTTTTTAGTCCGCTGAGATCGGTGGGCAGTTTCATGCAGCATTCCATGCAGCATTCCAACTTGTTTCACTTGAATCGGTTCCAGTGGGTCTGACCA

Full Affymetrix probeset data:

Annotations for 1638877_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720