FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638878_at:

>probe:Drosophila_2:1638878_at:25:205; Interrogation_Position=1062; Antisense; AAGCGGCAGTGGCAAAAGTTTCCAA
>probe:Drosophila_2:1638878_at:415:231; Interrogation_Position=1085; Antisense; AATGCACTTAACACTCTGTTCCGAA
>probe:Drosophila_2:1638878_at:631:181; Interrogation_Position=1126; Antisense; AAAACTGTCAGTGGCATTGGCAACA
>probe:Drosophila_2:1638878_at:403:529; Interrogation_Position=1236; Antisense; GGGATTACGGTTACGCTGTTGCGAC
>probe:Drosophila_2:1638878_at:462:13; Interrogation_Position=722; Antisense; ATTAAAGCCATGCTCGGTGCAACTC
>probe:Drosophila_2:1638878_at:304:535; Interrogation_Position=737; Antisense; GGTGCAACTCCTTTGCTTCATAAAG
>probe:Drosophila_2:1638878_at:378:5; Interrogation_Position=781; Antisense; ATTGTGCAGTTGGTTTTTGGCTAAC
>probe:Drosophila_2:1638878_at:586:691; Interrogation_Position=796; Antisense; TTTGGCTAACTTTCACTGCGATGCT
>probe:Drosophila_2:1638878_at:460:445; Interrogation_Position=815; Antisense; GATGCTCGAACAACTTCCCAGGGAT
>probe:Drosophila_2:1638878_at:50:275; Interrogation_Position=828; Antisense; CTTCCCAGGGATTAGTTGACGTGAC
>probe:Drosophila_2:1638878_at:582:721; Interrogation_Position=843; Antisense; TTGACGTGACCGGTTGGATTTGAGT
>probe:Drosophila_2:1638878_at:290:105; Interrogation_Position=887; Antisense; AGAAACGACAGCCAGCCAAGTTGCC
>probe:Drosophila_2:1638878_at:382:309; Interrogation_Position=902; Antisense; CCAAGTTGCCAAGTTTGCTCGAGGG
>probe:Drosophila_2:1638878_at:418:129; Interrogation_Position=980; Antisense; ACCATGCGTGGCAGGAGTGCACACA

Paste this into a BLAST search page for me
AAGCGGCAGTGGCAAAAGTTTCCAAAATGCACTTAACACTCTGTTCCGAAAAAACTGTCAGTGGCATTGGCAACAGGGATTACGGTTACGCTGTTGCGACATTAAAGCCATGCTCGGTGCAACTCGGTGCAACTCCTTTGCTTCATAAAGATTGTGCAGTTGGTTTTTGGCTAACTTTGGCTAACTTTCACTGCGATGCTGATGCTCGAACAACTTCCCAGGGATCTTCCCAGGGATTAGTTGACGTGACTTGACGTGACCGGTTGGATTTGAGTAGAAACGACAGCCAGCCAAGTTGCCCCAAGTTGCCAAGTTTGCTCGAGGGACCATGCGTGGCAGGAGTGCACACA

Full Affymetrix probeset data:

Annotations for 1638878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720