FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638880_at:

>probe:Drosophila_2:1638880_at:711:577; Interrogation_Position=109; Antisense; GGCCCGCACAATTATGACCATCAAA
>probe:Drosophila_2:1638880_at:646:401; Interrogation_Position=139; Antisense; GACTTGCTTTCGACATATTTGGGTT
>probe:Drosophila_2:1638880_at:75:149; Interrogation_Position=259; Antisense; ACTTCATGCCATTTCGGAGTTCCTA
>probe:Drosophila_2:1638880_at:603:477; Interrogation_Position=297; Antisense; GTATTCATGACTTTGCTCTATTCCA
>probe:Drosophila_2:1638880_at:359:9; Interrogation_Position=316; Antisense; ATTCCAATGCACATCTGTATTCCTG
>probe:Drosophila_2:1638880_at:85:333; Interrogation_Position=362; Antisense; GCTGTTCGAAAGTTTGAGTCCCATG
>probe:Drosophila_2:1638880_at:600:431; Interrogation_Position=377; Antisense; GAGTCCCATGACTGTGTTTTTGCCG
>probe:Drosophila_2:1638880_at:633:477; Interrogation_Position=392; Antisense; GTTTTTGCCGCTAAGAGATCACATT
>probe:Drosophila_2:1638880_at:459:363; Interrogation_Position=458; Antisense; GAATTCGATTTGAGTGCCAGGCCAA
>probe:Drosophila_2:1638880_at:441:401; Interrogation_Position=514; Antisense; GACAGGAATGTTTTACTTCTCGAGG
>probe:Drosophila_2:1638880_at:558:23; Interrogation_Position=573; Antisense; ATAGGTGCTCCGTTGTGGAAATCGA
>probe:Drosophila_2:1638880_at:613:559; Interrogation_Position=613; Antisense; GGAAATTGACTCTAGCCACGATCTG
>probe:Drosophila_2:1638880_at:301:313; Interrogation_Position=627; Antisense; GCCACGATCTGACTCTAGCCAAATA
>probe:Drosophila_2:1638880_at:59:163; Interrogation_Position=87; Antisense; AAATTGGTGGCTCATCGCTTTTGGC

Paste this into a BLAST search page for me
GGCCCGCACAATTATGACCATCAAAGACTTGCTTTCGACATATTTGGGTTACTTCATGCCATTTCGGAGTTCCTAGTATTCATGACTTTGCTCTATTCCAATTCCAATGCACATCTGTATTCCTGGCTGTTCGAAAGTTTGAGTCCCATGGAGTCCCATGACTGTGTTTTTGCCGGTTTTTGCCGCTAAGAGATCACATTGAATTCGATTTGAGTGCCAGGCCAAGACAGGAATGTTTTACTTCTCGAGGATAGGTGCTCCGTTGTGGAAATCGAGGAAATTGACTCTAGCCACGATCTGGCCACGATCTGACTCTAGCCAAATAAAATTGGTGGCTCATCGCTTTTGGC

Full Affymetrix probeset data:

Annotations for 1638880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720