FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638881_at:

>probe:Drosophila_2:1638881_at:350:585; Interrogation_Position=1006; Antisense; TGGAAGGAGCTTTCCAGCCAGTCCG
>probe:Drosophila_2:1638881_at:404:127; Interrogation_Position=1021; Antisense; AGCCAGTCCGCCTTCGAGTGGATAA
>probe:Drosophila_2:1638881_at:395:667; Interrogation_Position=1076; Antisense; TACAGGACGTGTGCGGTCAGGCAAT
>probe:Drosophila_2:1638881_at:521:483; Interrogation_Position=1113; Antisense; GTATCGCTCCATTCAGGACTTCAAT
>probe:Drosophila_2:1638881_at:359:403; Interrogation_Position=1129; Antisense; GACTTCAATCACTTTTCCCCGGAAT
>probe:Drosophila_2:1638881_at:131:301; Interrogation_Position=1146; Antisense; CCCGGAATCTTTCCAGCCAATTATG
>probe:Drosophila_2:1638881_at:278:51; Interrogation_Position=700; Antisense; ATGCTGCTTGTTCGCGATCCTCGGG
>probe:Drosophila_2:1638881_at:13:527; Interrogation_Position=723; Antisense; GGGCACCATATATTCCCGAATGAAT
>probe:Drosophila_2:1638881_at:711:191; Interrogation_Position=788; Antisense; AACTTTGCGGCGACATGGTCAGTGA
>probe:Drosophila_2:1638881_at:222:205; Interrogation_Position=839; Antisense; AAGCCTATCCACAGCGTTTTAGCAT
>probe:Drosophila_2:1638881_at:261:57; Interrogation_Position=872; Antisense; ATGAGGACTTGTTCCTACAGCCCGA
>probe:Drosophila_2:1638881_at:716:481; Interrogation_Position=913; Antisense; GTATTCGACTTTTACGGATTGCCCT
>probe:Drosophila_2:1638881_at:119:671; Interrogation_Position=925; Antisense; TACGGATTGCCCTTGGAACGAAACA
>probe:Drosophila_2:1638881_at:313:349; Interrogation_Position=977; Antisense; GCAGTGGCTACTTTTTTCAGTCCTC

Paste this into a BLAST search page for me
TGGAAGGAGCTTTCCAGCCAGTCCGAGCCAGTCCGCCTTCGAGTGGATAATACAGGACGTGTGCGGTCAGGCAATGTATCGCTCCATTCAGGACTTCAATGACTTCAATCACTTTTCCCCGGAATCCCGGAATCTTTCCAGCCAATTATGATGCTGCTTGTTCGCGATCCTCGGGGGGCACCATATATTCCCGAATGAATAACTTTGCGGCGACATGGTCAGTGAAAGCCTATCCACAGCGTTTTAGCATATGAGGACTTGTTCCTACAGCCCGAGTATTCGACTTTTACGGATTGCCCTTACGGATTGCCCTTGGAACGAAACAGCAGTGGCTACTTTTTTCAGTCCTC

Full Affymetrix probeset data:

Annotations for 1638881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720