FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638882_at:

>probe:Drosophila_2:1638882_at:687:97; Interrogation_Position=3747; Antisense; AGATCGATTGCCTGACTGGCGACCA
>probe:Drosophila_2:1638882_at:503:535; Interrogation_Position=3775; Antisense; GGTGCTCAGCACAGACATCGTAATG
>probe:Drosophila_2:1638882_at:20:657; Interrogation_Position=3795; Antisense; TAATGGACATCGGTTCCAGCCTGAA
>probe:Drosophila_2:1638882_at:501:313; Interrogation_Position=3813; Antisense; GCCTGAATCCGGCTATTGACATTGG
>probe:Drosophila_2:1638882_at:208:1; Interrogation_Position=3861; Antisense; AGGGCTATGGACTGTTCACTTTGGA
>probe:Drosophila_2:1638882_at:581:73; Interrogation_Position=3885; Antisense; AGGAACTCATGTACTCACCACAAGG
>probe:Drosophila_2:1638882_at:96:225; Interrogation_Position=3906; Antisense; AAGGCATGCTTTACTCCAGAGGTCC
>probe:Drosophila_2:1638882_at:268:349; Interrogation_Position=4013; Antisense; GCAGTCTACTCTTCCAAGGCAGTGG
>probe:Drosophila_2:1638882_at:22:225; Interrogation_Position=4028; Antisense; AAGGCAGTGGGTGAACCTCCGCTCT
>probe:Drosophila_2:1638882_at:531:545; Interrogation_Position=4058; Antisense; GGATCATCTGCATTCTTTGCCATTA
>probe:Drosophila_2:1638882_at:77:41; Interrogation_Position=4153; Antisense; ATCGGCACGCATTCGAATTGCTTGT
>probe:Drosophila_2:1638882_at:32:563; Interrogation_Position=4192; Antisense; GGAACTGCTTGAAATACCCGAACCA
>probe:Drosophila_2:1638882_at:630:301; Interrogation_Position=4209; Antisense; CCGAACCAGGATCATTTACGCCATG
>probe:Drosophila_2:1638882_at:63:709; Interrogation_Position=4224; Antisense; TTACGCCATGGAACATTGTGCCTTA

Paste this into a BLAST search page for me
AGATCGATTGCCTGACTGGCGACCAGGTGCTCAGCACAGACATCGTAATGTAATGGACATCGGTTCCAGCCTGAAGCCTGAATCCGGCTATTGACATTGGAGGGCTATGGACTGTTCACTTTGGAAGGAACTCATGTACTCACCACAAGGAAGGCATGCTTTACTCCAGAGGTCCGCAGTCTACTCTTCCAAGGCAGTGGAAGGCAGTGGGTGAACCTCCGCTCTGGATCATCTGCATTCTTTGCCATTAATCGGCACGCATTCGAATTGCTTGTGGAACTGCTTGAAATACCCGAACCACCGAACCAGGATCATTTACGCCATGTTACGCCATGGAACATTGTGCCTTA

Full Affymetrix probeset data:

Annotations for 1638882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720