Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638883_at:

>probe:Drosophila_2:1638883_at:635:363; Interrogation_Position=480; Antisense; GAATATTGCCAAGTGCCGTATCTGC
>probe:Drosophila_2:1638883_at:730:621; Interrogation_Position=500; Antisense; TCTGCAACGGTGAGCATTGGTCGGT
>probe:Drosophila_2:1638883_at:365:3; Interrogation_Position=515; Antisense; ATTGGTCGGTCAACTGCCCGTACAA
>probe:Drosophila_2:1638883_at:264:49; Interrogation_Position=605; Antisense; ATGCGCCCAAGTCCGGCAAGTATGT
>probe:Drosophila_2:1638883_at:113:259; Interrogation_Position=687; Antisense; CACGGCCGCCATTAGGATATCGAAT
>probe:Drosophila_2:1638883_at:672:101; Interrogation_Position=770; Antisense; AGAGCAAGATGTATCTCGCCCGCGA
>probe:Drosophila_2:1638883_at:315:107; Interrogation_Position=797; Antisense; AGAACACCGGACTCTGCAAGGGATT
>probe:Drosophila_2:1638883_at:84:97; Interrogation_Position=869; Antisense; AGATCCTCAATGGACACGGCTACGA
>probe:Drosophila_2:1638883_at:556:721; Interrogation_Position=898; Antisense; TTGATCCTCAGCGTCGAATGGTCGA
>probe:Drosophila_2:1638883_at:201:371; Interrogation_Position=913; Antisense; GAATGGTCGAAACCCCAGAACAATT
>probe:Drosophila_2:1638883_at:283:671; Interrogation_Position=956; Antisense; TACCCGCGTTTACTGCTCATAGGAG
>probe:Drosophila_2:1638883_at:127:273; Interrogation_Position=973; Antisense; CATAGGAGTCCGTTCGAGTCGATCA
>probe:Drosophila_2:1638883_at:547:471; Interrogation_Position=984; Antisense; GTTCGAGTCGATCACACAATTTGTC
>probe:Drosophila_2:1638883_at:202:161; Interrogation_Position=999; Antisense; ACAATTTGTCCCTATGCTATGCTAA

Paste this into a BLAST search page for me
GAATATTGCCAAGTGCCGTATCTGCTCTGCAACGGTGAGCATTGGTCGGTATTGGTCGGTCAACTGCCCGTACAAATGCGCCCAAGTCCGGCAAGTATGTCACGGCCGCCATTAGGATATCGAATAGAGCAAGATGTATCTCGCCCGCGAAGAACACCGGACTCTGCAAGGGATTAGATCCTCAATGGACACGGCTACGATTGATCCTCAGCGTCGAATGGTCGAGAATGGTCGAAACCCCAGAACAATTTACCCGCGTTTACTGCTCATAGGAGCATAGGAGTCCGTTCGAGTCGATCAGTTCGAGTCGATCACACAATTTGTCACAATTTGTCCCTATGCTATGCTAA

Full Affymetrix probeset data:

Annotations for 1638883_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime