Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638884_at:

>probe:Drosophila_2:1638884_at:561:557; Interrogation_Position=2359; Antisense; GGACAGCTGAGCAAGACCATCGAAC
>probe:Drosophila_2:1638884_at:361:409; Interrogation_Position=2373; Antisense; GACCATCGAACTGATACCCAACGGG
>probe:Drosophila_2:1638884_at:155:211; Interrogation_Position=2425; Antisense; AAGAACCAGTACCTGGATGCCCTGG
>probe:Drosophila_2:1638884_at:661:113; Interrogation_Position=2453; Antisense; AGCAGCGTCTGTGCAACAACGTCAA
>probe:Drosophila_2:1638884_at:292:543; Interrogation_Position=2523; Antisense; GGATAACCTTCTCAGCATTTTCGAT
>probe:Drosophila_2:1638884_at:49:651; Interrogation_Position=2594; Antisense; TCAGCGACTTTAAGGCGCACCACAT
>probe:Drosophila_2:1638884_at:486:311; Interrogation_Position=2620; Antisense; GCCAACGGCAATTCGGCTGAGTTTC
>probe:Drosophila_2:1638884_at:430:475; Interrogation_Position=2661; Antisense; GTTTTGGGCCGGAGTGAGCAACTTC
>probe:Drosophila_2:1638884_at:408:609; Interrogation_Position=2675; Antisense; TGAGCAACTTCAGCCAGACGGAGAT
>probe:Drosophila_2:1638884_at:722:463; Interrogation_Position=2750; Antisense; GATTCCAGGAGCTAAATCCGCAGTT
>probe:Drosophila_2:1638884_at:114:267; Interrogation_Position=2770; Antisense; CAGTTCCAGATAACGGCGGCTCCGA
>probe:Drosophila_2:1638884_at:707:477; Interrogation_Position=2825; Antisense; GTTTCAACCAGCTGTGTTTGCCCGA
>probe:Drosophila_2:1638884_at:549:91; Interrogation_Position=2867; Antisense; AGTTCGAGAAGTCGCTGCTTTTGGC
>probe:Drosophila_2:1638884_at:262:619; Interrogation_Position=2882; Antisense; TGCTTTTGGCCATCAGCGAGGGCAG

Paste this into a BLAST search page for me
GGACAGCTGAGCAAGACCATCGAACGACCATCGAACTGATACCCAACGGGAAGAACCAGTACCTGGATGCCCTGGAGCAGCGTCTGTGCAACAACGTCAAGGATAACCTTCTCAGCATTTTCGATTCAGCGACTTTAAGGCGCACCACATGCCAACGGCAATTCGGCTGAGTTTCGTTTTGGGCCGGAGTGAGCAACTTCTGAGCAACTTCAGCCAGACGGAGATGATTCCAGGAGCTAAATCCGCAGTTCAGTTCCAGATAACGGCGGCTCCGAGTTTCAACCAGCTGTGTTTGCCCGAAGTTCGAGAAGTCGCTGCTTTTGGCTGCTTTTGGCCATCAGCGAGGGCAG

Full Affymetrix probeset data:

Annotations for 1638884_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime