FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638885_at:

>probe:Drosophila_2:1638885_at:454:635; Interrogation_Position=110; Antisense; TCGAGGAGAGCCAGTGATTGTCCGC
>probe:Drosophila_2:1638885_at:233:65; Interrogation_Position=13; Antisense; ATGGGAACAGCAAGCGCGTTACCTT
>probe:Drosophila_2:1638885_at:660:519; Interrogation_Position=172; Antisense; GTGGACCGTGTCTATGGCACTGGAC
>probe:Drosophila_2:1638885_at:727:65; Interrogation_Position=185; Antisense; ATGGCACTGGACGTATTCCCGGCAA
>probe:Drosophila_2:1638885_at:131:299; Interrogation_Position=272; Antisense; CCGTTAATCAGTATCCCAAGGTGGT
>probe:Drosophila_2:1638885_at:46:327; Interrogation_Position=28; Antisense; GCGTTACCTTTGAAACAGCCACCTT
>probe:Drosophila_2:1638885_at:173:687; Interrogation_Position=301; Antisense; TATACAATTAGCTATCCACTCCGAC
>probe:Drosophila_2:1638885_at:597:683; Interrogation_Position=313; Antisense; TATCCACTCCGACCGCAAAATGAAT
>probe:Drosophila_2:1638885_at:78:167; Interrogation_Position=330; Antisense; AAATGAATCCTTACACTTGCGCAGT
>probe:Drosophila_2:1638885_at:605:707; Interrogation_Position=340; Antisense; TTACACTTGCGCAGTTCAACTTCAC
>probe:Drosophila_2:1638885_at:212:563; Interrogation_Position=388; Antisense; GGAATGCTCTCTTGCGCTATAAATT
>probe:Drosophila_2:1638885_at:577:459; Interrogation_Position=441; Antisense; GATTTGCATGCCTATTATGTTTTGA
>probe:Drosophila_2:1638885_at:329:477; Interrogation_Position=459; Antisense; GTTTTGATTTTGATTCCTGAGCTTG
>probe:Drosophila_2:1638885_at:510:463; Interrogation_Position=470; Antisense; GATTCCTGAGCTTGTAATTTTCTAT

Paste this into a BLAST search page for me
TCGAGGAGAGCCAGTGATTGTCCGCATGGGAACAGCAAGCGCGTTACCTTGTGGACCGTGTCTATGGCACTGGACATGGCACTGGACGTATTCCCGGCAACCGTTAATCAGTATCCCAAGGTGGTGCGTTACCTTTGAAACAGCCACCTTTATACAATTAGCTATCCACTCCGACTATCCACTCCGACCGCAAAATGAATAAATGAATCCTTACACTTGCGCAGTTTACACTTGCGCAGTTCAACTTCACGGAATGCTCTCTTGCGCTATAAATTGATTTGCATGCCTATTATGTTTTGAGTTTTGATTTTGATTCCTGAGCTTGGATTCCTGAGCTTGTAATTTTCTAT

Full Affymetrix probeset data:

Annotations for 1638885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720