FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638886_at:

>probe:Drosophila_2:1638886_at:152:241; Interrogation_Position=1015; Antisense; AATAACCTGGCGAAGCACCGACGAC
>probe:Drosophila_2:1638886_at:450:665; Interrogation_Position=1060; Antisense; TACAAGTGTTCCATCTGCCTGCAGG
>probe:Drosophila_2:1638886_at:637:145; Interrogation_Position=1098; Antisense; ACATCATCTGAAGCGGCACTTTCTG
>probe:Drosophila_2:1638886_at:615:701; Interrogation_Position=567; Antisense; TTTTCTGTTCAAGGCCGATCTGGAT
>probe:Drosophila_2:1638886_at:702:355; Interrogation_Position=608; Antisense; GCAATAGCAATTCCACCGTCGAGTG
>probe:Drosophila_2:1638886_at:195:505; Interrogation_Position=630; Antisense; GTGCCCGGAATGCTTAAAGGTCTTT
>probe:Drosophila_2:1638886_at:556:169; Interrogation_Position=645; Antisense; AAAGGTCTTTTCAAGCACCCAGAGC
>probe:Drosophila_2:1638886_at:271:69; Interrogation_Position=689; Antisense; AGGATATGCAGGAGCGTTCGCCCTT
>probe:Drosophila_2:1638886_at:378:115; Interrogation_Position=731; Antisense; AGCAGGCCTTTACTCGCGAACAAAA
>probe:Drosophila_2:1638886_at:566:129; Interrogation_Position=767; Antisense; ACCTGTTGATCCACGCGGAATCGAA
>probe:Drosophila_2:1638886_at:2:557; Interrogation_Position=796; Antisense; GGAAACGGACCCCACAAATGTTCAT
>probe:Drosophila_2:1638886_at:538:471; Interrogation_Position=815; Antisense; GTTCATACTGCCAAACGGGATTCTT
>probe:Drosophila_2:1638886_at:407:543; Interrogation_Position=832; Antisense; GGATTCTTCAACAAGTCGGCCCTCA
>probe:Drosophila_2:1638886_at:239:221; Interrogation_Position=856; Antisense; AAGGTGCACATCCATGCGCACATGG

Paste this into a BLAST search page for me
AATAACCTGGCGAAGCACCGACGACTACAAGTGTTCCATCTGCCTGCAGGACATCATCTGAAGCGGCACTTTCTGTTTTCTGTTCAAGGCCGATCTGGATGCAATAGCAATTCCACCGTCGAGTGGTGCCCGGAATGCTTAAAGGTCTTTAAAGGTCTTTTCAAGCACCCAGAGCAGGATATGCAGGAGCGTTCGCCCTTAGCAGGCCTTTACTCGCGAACAAAAACCTGTTGATCCACGCGGAATCGAAGGAAACGGACCCCACAAATGTTCATGTTCATACTGCCAAACGGGATTCTTGGATTCTTCAACAAGTCGGCCCTCAAAGGTGCACATCCATGCGCACATGG

Full Affymetrix probeset data:

Annotations for 1638886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720