FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638888_at:

>probe:Drosophila_2:1638888_at:332:315; Interrogation_Position=1105; Antisense; GCCTTCACTTCGGAGCAGCTGCTGG
>probe:Drosophila_2:1638888_at:38:95; Interrogation_Position=1142; Antisense; AGTTCCACGCCAAGAAGTATCTCAG
>probe:Drosophila_2:1638888_at:335:91; Interrogation_Position=1157; Antisense; AGTATCTCAGTCTCACGGAGCGCAG
>probe:Drosophila_2:1638888_at:392:417; Interrogation_Position=1174; Antisense; GAGCGCAGTCAAATAGCCACCAGTC
>probe:Drosophila_2:1638888_at:424:221; Interrogation_Position=1257; Antisense; AAGGGTTAAGGCTGGACTCACCTCG
>probe:Drosophila_2:1638888_at:618:359; Interrogation_Position=1295; Antisense; GCAACGGGACCACTAGTGGCACCAA
>probe:Drosophila_2:1638888_at:163:215; Interrogation_Position=1387; Antisense; AAGATGTGCCTCAGCGGACCGAAGC
>probe:Drosophila_2:1638888_at:370:609; Interrogation_Position=1454; Antisense; TCGAGAAGTTCAGCGGTTCCACCAA
>probe:Drosophila_2:1638888_at:505:45; Interrogation_Position=1485; Antisense; ATCGCCATCCGGAGGACCAGTGGGA
>probe:Drosophila_2:1638888_at:401:633; Interrogation_Position=1567; Antisense; TCCCTCGCCAGGAGCATCTATTGAT
>probe:Drosophila_2:1638888_at:405:427; Interrogation_Position=1593; Antisense; GAGTTGGGCTCCTGAAGCGTTCAAG
>probe:Drosophila_2:1638888_at:508:377; Interrogation_Position=1606; Antisense; GAAGCGTTCAAGTGTACATACCTAT
>probe:Drosophila_2:1638888_at:636:149; Interrogation_Position=1621; Antisense; ACATACCTATGGAGGCAGTTCGTCT
>probe:Drosophila_2:1638888_at:658:499; Interrogation_Position=1642; Antisense; GTCTGCAAGCCGAGTTTTCTTTATG

Paste this into a BLAST search page for me
GCCTTCACTTCGGAGCAGCTGCTGGAGTTCCACGCCAAGAAGTATCTCAGAGTATCTCAGTCTCACGGAGCGCAGGAGCGCAGTCAAATAGCCACCAGTCAAGGGTTAAGGCTGGACTCACCTCGGCAACGGGACCACTAGTGGCACCAAAAGATGTGCCTCAGCGGACCGAAGCTCGAGAAGTTCAGCGGTTCCACCAAATCGCCATCCGGAGGACCAGTGGGATCCCTCGCCAGGAGCATCTATTGATGAGTTGGGCTCCTGAAGCGTTCAAGGAAGCGTTCAAGTGTACATACCTATACATACCTATGGAGGCAGTTCGTCTGTCTGCAAGCCGAGTTTTCTTTATG

Full Affymetrix probeset data:

Annotations for 1638888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720