Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638889_at:

>probe:Drosophila_2:1638889_at:193:547; Interrogation_Position=1279; Antisense; GGATGGATAGACAGCTGCCTCCCAA
>probe:Drosophila_2:1638889_at:208:173; Interrogation_Position=1302; Antisense; AAAGCACTCGCTCCGCAAACTAGCT
>probe:Drosophila_2:1638889_at:225:177; Interrogation_Position=1318; Antisense; AAACTAGCTCGCTTTCCATTTTAGC
>probe:Drosophila_2:1638889_at:458:337; Interrogation_Position=1324; Antisense; GCTCGCTTTCCATTTTAGCCGTAAA
>probe:Drosophila_2:1638889_at:398:649; Interrogation_Position=1390; Antisense; TCACTTCCACAGAGAGACTGCCAGT
>probe:Drosophila_2:1638889_at:698:179; Interrogation_Position=1438; Antisense; AAACAACTTCTCCATGAACTCTTCC
>probe:Drosophila_2:1638889_at:242:645; Interrogation_Position=1457; Antisense; TCTTCCCACGGATTATGAGACGCGC
>probe:Drosophila_2:1638889_at:259:609; Interrogation_Position=1472; Antisense; TGAGACGCGCAAACCGTAGACTTGT
>probe:Drosophila_2:1638889_at:404:485; Interrogation_Position=1487; Antisense; GTAGACTTGTCCCTATACCTTAAAT
>probe:Drosophila_2:1638889_at:419:27; Interrogation_Position=1501; Antisense; ATACCTTAAATTTCAGCCCGATGTG
>probe:Drosophila_2:1638889_at:637:697; Interrogation_Position=1511; Antisense; TTTCAGCCCGATGTGTGCTGCAAAT
>probe:Drosophila_2:1638889_at:52:237; Interrogation_Position=1676; Antisense; AATCGCTTTGTAAATGAGCCCAATA
>probe:Drosophila_2:1638889_at:178:85; Interrogation_Position=1734; Antisense; AGTGTCTGGCTTGTATTTGTGGATA
>probe:Drosophila_2:1638889_at:488:691; Interrogation_Position=1749; Antisense; TTTGTGGATATGTTACGCGACCTAA

Paste this into a BLAST search page for me
GGATGGATAGACAGCTGCCTCCCAAAAAGCACTCGCTCCGCAAACTAGCTAAACTAGCTCGCTTTCCATTTTAGCGCTCGCTTTCCATTTTAGCCGTAAATCACTTCCACAGAGAGACTGCCAGTAAACAACTTCTCCATGAACTCTTCCTCTTCCCACGGATTATGAGACGCGCTGAGACGCGCAAACCGTAGACTTGTGTAGACTTGTCCCTATACCTTAAATATACCTTAAATTTCAGCCCGATGTGTTTCAGCCCGATGTGTGCTGCAAATAATCGCTTTGTAAATGAGCCCAATAAGTGTCTGGCTTGTATTTGTGGATATTTGTGGATATGTTACGCGACCTAA

Full Affymetrix probeset data:

Annotations for 1638889_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime