FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638890_at:

>probe:Drosophila_2:1638890_at:633:511; Interrogation_Position=249; Antisense; GTGAGCTCTTTCAGCACCCAGGATG
>probe:Drosophila_2:1638890_at:31:79; Interrogation_Position=268; Antisense; AGGATGCCACGATTCTGACCCAGCT
>probe:Drosophila_2:1638890_at:573:269; Interrogation_Position=297; Antisense; CATGTGGGCGAGTTCACGCTGCAGT
>probe:Drosophila_2:1638890_at:16:577; Interrogation_Position=393; Antisense; GGCGACAACAAGTACCAGGTGAGCT
>probe:Drosophila_2:1638890_at:190:115; Interrogation_Position=433; Antisense; AGCAGGGCAGCAGCGGCAATGTTCA
>probe:Drosophila_2:1638890_at:613:249; Interrogation_Position=449; Antisense; CAATGTTCAGGTGCGTCTCTTCGAC
>probe:Drosophila_2:1638890_at:393:697; Interrogation_Position=523; Antisense; TTTCATCGGTGAAGTCGCTGCTCGA
>probe:Drosophila_2:1638890_at:64:81; Interrogation_Position=565; Antisense; AGGGTGCCTACAAGGGTCCCTGGAT
>probe:Drosophila_2:1638890_at:552:503; Interrogation_Position=580; Antisense; GTCCCTGGATCAAGGCTGAGCTTTT
>probe:Drosophila_2:1638890_at:571:589; Interrogation_Position=616; Antisense; TGGTCGGCGGATTCGCATACTTCGC
>probe:Drosophila_2:1638890_at:684:435; Interrogation_Position=675; Antisense; GAGGATGCCTTCGTCATCGAGATTT
>probe:Drosophila_2:1638890_at:504:59; Interrogation_Position=727; Antisense; ATGTACCATCAAATTGCCGGGTCCC
>probe:Drosophila_2:1638890_at:538:503; Interrogation_Position=747; Antisense; GTCCCGGAGATTTTTCCACATTTTG
>probe:Drosophila_2:1638890_at:590:691; Interrogation_Position=768; Antisense; TTTGTACACCTAAGCATCGGATCAC

Paste this into a BLAST search page for me
GTGAGCTCTTTCAGCACCCAGGATGAGGATGCCACGATTCTGACCCAGCTCATGTGGGCGAGTTCACGCTGCAGTGGCGACAACAAGTACCAGGTGAGCTAGCAGGGCAGCAGCGGCAATGTTCACAATGTTCAGGTGCGTCTCTTCGACTTTCATCGGTGAAGTCGCTGCTCGAAGGGTGCCTACAAGGGTCCCTGGATGTCCCTGGATCAAGGCTGAGCTTTTTGGTCGGCGGATTCGCATACTTCGCGAGGATGCCTTCGTCATCGAGATTTATGTACCATCAAATTGCCGGGTCCCGTCCCGGAGATTTTTCCACATTTTGTTTGTACACCTAAGCATCGGATCAC

Full Affymetrix probeset data:

Annotations for 1638890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720