Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638892_at:

>probe:Drosophila_2:1638892_at:228:365; Interrogation_Position=1542; Antisense; GAAGGGTCTACCAATTGTCTCGGAA
>probe:Drosophila_2:1638892_at:545:5; Interrogation_Position=1555; Antisense; ATTGTCTCGGAAACAGCCCATGATA
>probe:Drosophila_2:1638892_at:391:427; Interrogation_Position=1606; Antisense; GAGATCGGCTACATGTTCGATGCAA
>probe:Drosophila_2:1638892_at:384:549; Interrogation_Position=1653; Antisense; GGAGGAGACTCGTTTGACCAGCGCC
>probe:Drosophila_2:1638892_at:38:545; Interrogation_Position=1680; Antisense; GGATCTCAAAGTGCGCAACAACCTC
>probe:Drosophila_2:1638892_at:279:201; Interrogation_Position=1699; Antisense; AACCTCATCGATCTGTTGGTCAAGT
>probe:Drosophila_2:1638892_at:354:431; Interrogation_Position=1770; Antisense; GAGTGTTACGGGAAAAGCCACGCCT
>probe:Drosophila_2:1638892_at:147:677; Interrogation_Position=1805; Antisense; TAGATACCAAACTGCAGACCTCCAA
>probe:Drosophila_2:1638892_at:207:283; Interrogation_Position=1824; Antisense; CTCCAATGATTTCCGCTTCTGCGAA
>probe:Drosophila_2:1638892_at:386:713; Interrogation_Position=1840; Antisense; TTCTGCGAATTGTCCGTTCTGGGCG
>probe:Drosophila_2:1638892_at:259:657; Interrogation_Position=1880; Antisense; TAAGTTCCACCAGCTGTGCGGGATT
>probe:Drosophila_2:1638892_at:261:465; Interrogation_Position=1901; Antisense; GATTGGGTAACTTGCTAGGTCAACT
>probe:Drosophila_2:1638892_at:391:515; Interrogation_Position=2015; Antisense; GTGGTCTCGGTCTTGGAATTTTGTA
>probe:Drosophila_2:1638892_at:301:515; Interrogation_Position=2046; Antisense; GTGTTACCTCTATCACATTGTTGTG

Paste this into a BLAST search page for me
GAAGGGTCTACCAATTGTCTCGGAAATTGTCTCGGAAACAGCCCATGATAGAGATCGGCTACATGTTCGATGCAAGGAGGAGACTCGTTTGACCAGCGCCGGATCTCAAAGTGCGCAACAACCTCAACCTCATCGATCTGTTGGTCAAGTGAGTGTTACGGGAAAAGCCACGCCTTAGATACCAAACTGCAGACCTCCAACTCCAATGATTTCCGCTTCTGCGAATTCTGCGAATTGTCCGTTCTGGGCGTAAGTTCCACCAGCTGTGCGGGATTGATTGGGTAACTTGCTAGGTCAACTGTGGTCTCGGTCTTGGAATTTTGTAGTGTTACCTCTATCACATTGTTGTG

Full Affymetrix probeset data:

Annotations for 1638892_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime