Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638893_at:

>probe:Drosophila_2:1638893_at:406:361; Interrogation_Position=5018; Antisense; GCAAGGACTCGAGTATGCTCAAGGA
>probe:Drosophila_2:1638893_at:530:525; Interrogation_Position=5091; Antisense; GGGCAATTCGACTGGCTCCAACTCA
>probe:Drosophila_2:1638893_at:503:193; Interrogation_Position=5110; Antisense; AACTCAGCGCCAAGGTCTAGGATTC
>probe:Drosophila_2:1638893_at:465:277; Interrogation_Position=5126; Antisense; CTAGGATTCCTAGGCCTGTTAGCTA
>probe:Drosophila_2:1638893_at:629:473; Interrogation_Position=5143; Antisense; GTTAGCTACCCAGCGGGCAGAAGTT
>probe:Drosophila_2:1638893_at:618:311; Interrogation_Position=5227; Antisense; GCCACTCCCAAGACTGTCACTAAAA
>probe:Drosophila_2:1638893_at:409:675; Interrogation_Position=5289; Antisense; TAGCAGACTGACCAGCGCCCAGGAA
>probe:Drosophila_2:1638893_at:168:573; Interrogation_Position=5320; Antisense; GGCGGTAACAAGGTCAGCACTCGAT
>probe:Drosophila_2:1638893_at:421:635; Interrogation_Position=5344; Antisense; TCGCCCAGCAGGATTGTGCAGCCAA
>probe:Drosophila_2:1638893_at:179:205; Interrogation_Position=5368; Antisense; AAGCGTTATAGTCTTGCCGGTGCGA
>probe:Drosophila_2:1638893_at:641:41; Interrogation_Position=5444; Antisense; ATCGAGTGGCGGTTACGGCGCCAAA
>probe:Drosophila_2:1638893_at:168:177; Interrogation_Position=5476; Antisense; AAACGACAGGCGGTTGCCCAGTCGC
>probe:Drosophila_2:1638893_at:140:327; Interrogation_Position=5514; Antisense; GCGAGTGCGTTGAGCGTCCACACGA
>probe:Drosophila_2:1638893_at:47:207; Interrogation_Position=5543; Antisense; AAGCGTCCAAGTCATCCCAATTAGT

Paste this into a BLAST search page for me
GCAAGGACTCGAGTATGCTCAAGGAGGGCAATTCGACTGGCTCCAACTCAAACTCAGCGCCAAGGTCTAGGATTCCTAGGATTCCTAGGCCTGTTAGCTAGTTAGCTACCCAGCGGGCAGAAGTTGCCACTCCCAAGACTGTCACTAAAATAGCAGACTGACCAGCGCCCAGGAAGGCGGTAACAAGGTCAGCACTCGATTCGCCCAGCAGGATTGTGCAGCCAAAAGCGTTATAGTCTTGCCGGTGCGAATCGAGTGGCGGTTACGGCGCCAAAAAACGACAGGCGGTTGCCCAGTCGCGCGAGTGCGTTGAGCGTCCACACGAAAGCGTCCAAGTCATCCCAATTAGT

Full Affymetrix probeset data:

Annotations for 1638893_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime