FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638896_at:

>probe:Drosophila_2:1638896_at:272:335; Interrogation_Position=1089; Antisense; GCTGAAACGGCTGACAATGCTATAA
>probe:Drosophila_2:1638896_at:256:347; Interrogation_Position=613; Antisense; GCATGTGGCCCACTACTAAGGAAGT
>probe:Drosophila_2:1638896_at:571:587; Interrogation_Position=637; Antisense; TGGAGCAGTCCGCTGGATGCACCAC
>probe:Drosophila_2:1638896_at:666:337; Interrogation_Position=681; Antisense; GCTAACACCACTCTTCTGTAATTTA
>probe:Drosophila_2:1638896_at:632:709; Interrogation_Position=706; Antisense; TTAAGCACGTTGACGACCTCACAAA
>probe:Drosophila_2:1638896_at:122:645; Interrogation_Position=724; Antisense; TCACAAAACGGCTGATCGATCCACT
>probe:Drosophila_2:1638896_at:204:449; Interrogation_Position=741; Antisense; GATCCACTGACGAAGCCTGCTAAAA
>probe:Drosophila_2:1638896_at:587:241; Interrogation_Position=764; Antisense; AATACTCAGTACCACAGTCATGTCC
>probe:Drosophila_2:1638896_at:618:61; Interrogation_Position=783; Antisense; ATGTCCATCATGTCCTGCCGTGGAT
>probe:Drosophila_2:1638896_at:93:639; Interrogation_Position=867; Antisense; TCTGTCTCAGCTTTCGCGCAATTCT
>probe:Drosophila_2:1638896_at:284:325; Interrogation_Position=882; Antisense; GCGCAATTCTCTCTTTTGTTTGTTA
>probe:Drosophila_2:1638896_at:598:473; Interrogation_Position=903; Antisense; GTTAATCAACCTTCTCTTTAATTGT
>probe:Drosophila_2:1638896_at:443:433; Interrogation_Position=944; Antisense; GAGTGAGGAACAAACGCCCATCCTG
>probe:Drosophila_2:1638896_at:577:133; Interrogation_Position=973; Antisense; ACGCCCACGAAGAAGAACCAACCTG

Paste this into a BLAST search page for me
GCTGAAACGGCTGACAATGCTATAAGCATGTGGCCCACTACTAAGGAAGTTGGAGCAGTCCGCTGGATGCACCACGCTAACACCACTCTTCTGTAATTTATTAAGCACGTTGACGACCTCACAAATCACAAAACGGCTGATCGATCCACTGATCCACTGACGAAGCCTGCTAAAAAATACTCAGTACCACAGTCATGTCCATGTCCATCATGTCCTGCCGTGGATTCTGTCTCAGCTTTCGCGCAATTCTGCGCAATTCTCTCTTTTGTTTGTTAGTTAATCAACCTTCTCTTTAATTGTGAGTGAGGAACAAACGCCCATCCTGACGCCCACGAAGAAGAACCAACCTG

Full Affymetrix probeset data:

Annotations for 1638896_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720