Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638897_at:

>probe:Drosophila_2:1638897_at:303:223; Interrogation_Position=1578; Antisense; AAGGAGGACATTATCGCCGTGCCGG
>probe:Drosophila_2:1638897_at:455:563; Interrogation_Position=1601; Antisense; GGAAGCTTCAGTCGTGCAACGCATC
>probe:Drosophila_2:1638897_at:704:37; Interrogation_Position=1623; Antisense; ATCTACGAGAACGTGGTGCTCCACA
>probe:Drosophila_2:1638897_at:412:621; Interrogation_Position=1639; Antisense; TGCTCCACACCACGAAAGGCGATAT
>probe:Drosophila_2:1638897_at:583:457; Interrogation_Position=1659; Antisense; GATATCCACATGAGGCTGTTCTTCA
>probe:Drosophila_2:1638897_at:418:689; Interrogation_Position=1750; Antisense; TATTCCATCGCGTGATCAAGGGCTT
>probe:Drosophila_2:1638897_at:450:713; Interrogation_Position=1773; Antisense; TTCATGGTGCAGACTGGCGATCCCA
>probe:Drosophila_2:1638897_at:283:67; Interrogation_Position=1844; Antisense; AGACGAGTTCGTGCCGAGCCTGAAA
>probe:Drosophila_2:1638897_at:45:573; Interrogation_Position=1895; Antisense; GGCTAACGCGGGTCCAAACACGAAT
>probe:Drosophila_2:1638897_at:437:379; Interrogation_Position=1921; Antisense; GAAGCCAGTTCTTTATCACAGTCCT
>probe:Drosophila_2:1638897_at:137:573; Interrogation_Position=1957; Antisense; GGCTCGACAACAAGCACACGGTGTT
>probe:Drosophila_2:1638897_at:307:435; Interrogation_Position=2004; Antisense; GAGGTGGTTCTCAACATTTGCAATT
>probe:Drosophila_2:1638897_at:248:559; Interrogation_Position=2048; Antisense; GGACAAGCCCTACGACGACATTAAA
>probe:Drosophila_2:1638897_at:439:399; Interrogation_Position=2127; Antisense; GACACTGGTTTTCAAATCTTCGGAG

Paste this into a BLAST search page for me
AAGGAGGACATTATCGCCGTGCCGGGGAAGCTTCAGTCGTGCAACGCATCATCTACGAGAACGTGGTGCTCCACATGCTCCACACCACGAAAGGCGATATGATATCCACATGAGGCTGTTCTTCATATTCCATCGCGTGATCAAGGGCTTTTCATGGTGCAGACTGGCGATCCCAAGACGAGTTCGTGCCGAGCCTGAAAGGCTAACGCGGGTCCAAACACGAATGAAGCCAGTTCTTTATCACAGTCCTGGCTCGACAACAAGCACACGGTGTTGAGGTGGTTCTCAACATTTGCAATTGGACAAGCCCTACGACGACATTAAAGACACTGGTTTTCAAATCTTCGGAG

Full Affymetrix probeset data:

Annotations for 1638897_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime