Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638898_at:

>probe:Drosophila_2:1638898_at:675:453; Interrogation_Position=1012; Antisense; GATAAGCTATCAACAGGAACCTCAT
>probe:Drosophila_2:1638898_at:376:217; Interrogation_Position=1133; Antisense; AAGTAGCCGCTTCGTTCGATTTAAT
>probe:Drosophila_2:1638898_at:361:163; Interrogation_Position=1189; Antisense; AAATTTCCAACGGTGTGTTGATCAA
>probe:Drosophila_2:1638898_at:729:701; Interrogation_Position=1232; Antisense; TTAGCTGCAACTACAGGTACGGCAA
>probe:Drosophila_2:1638898_at:376:583; Interrogation_Position=689; Antisense; TGGCGTCAGCCAATTGATTACCAAA
>probe:Drosophila_2:1638898_at:580:45; Interrogation_Position=772; Antisense; ATCCTATCAGGAACACGACGACTGT
>probe:Drosophila_2:1638898_at:641:407; Interrogation_Position=788; Antisense; GACGACTGTCGAAGACGCGACCGCT
>probe:Drosophila_2:1638898_at:45:413; Interrogation_Position=806; Antisense; GACCGCTGGAACCAACATCCTTATG
>probe:Drosophila_2:1638898_at:396:705; Interrogation_Position=826; Antisense; TTATGCCCGTAACCATAGACCGCAT
>probe:Drosophila_2:1638898_at:421:441; Interrogation_Position=893; Antisense; GATGGATATCAGCAGGGCTCGAACC
>probe:Drosophila_2:1638898_at:8:81; Interrogation_Position=906; Antisense; AGGGCTCGAACCAACATCCTTATTC
>probe:Drosophila_2:1638898_at:602:697; Interrogation_Position=925; Antisense; TTATTCCCGTAACCATAGACCGCAT
>probe:Drosophila_2:1638898_at:191:491; Interrogation_Position=978; Antisense; GTAACCGATCAGGAGGAGGCTATCA
>probe:Drosophila_2:1638898_at:272:77; Interrogation_Position=991; Antisense; AGGAGGCTATCAGCAGGGCTCGATA

Paste this into a BLAST search page for me
GATAAGCTATCAACAGGAACCTCATAAGTAGCCGCTTCGTTCGATTTAATAAATTTCCAACGGTGTGTTGATCAATTAGCTGCAACTACAGGTACGGCAATGGCGTCAGCCAATTGATTACCAAAATCCTATCAGGAACACGACGACTGTGACGACTGTCGAAGACGCGACCGCTGACCGCTGGAACCAACATCCTTATGTTATGCCCGTAACCATAGACCGCATGATGGATATCAGCAGGGCTCGAACCAGGGCTCGAACCAACATCCTTATTCTTATTCCCGTAACCATAGACCGCATGTAACCGATCAGGAGGAGGCTATCAAGGAGGCTATCAGCAGGGCTCGATA

Full Affymetrix probeset data:

Annotations for 1638898_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime