FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638901_at:

>probe:Drosophila_2:1638901_at:179:3; Interrogation_Position=1011; Antisense; ATTACCAACTGCTCCCGGAACTGTG
>probe:Drosophila_2:1638901_at:434:385; Interrogation_Position=1073; Antisense; GAACTTCGGCCACTGCTATAGCAGA
>probe:Drosophila_2:1638901_at:503:377; Interrogation_Position=1141; Antisense; GAAGCTCCTGCAGCAGAGGCGCCTG
>probe:Drosophila_2:1638901_at:118:109; Interrogation_Position=1215; Antisense; AGAAGAGGCTGCACCGGAAGCCGCC
>probe:Drosophila_2:1638901_at:371:633; Interrogation_Position=1329; Antisense; TCCCGCTGAAGAAGCTCCCGCAGAA
>probe:Drosophila_2:1638901_at:345:211; Interrogation_Position=1352; Antisense; AAGAAGCTCCCGCAGCTGAGTAGAT
>probe:Drosophila_2:1638901_at:25:335; Interrogation_Position=1385; Antisense; GCTGTGTTTATTAATTTTCCCTTAG
>probe:Drosophila_2:1638901_at:679:671; Interrogation_Position=861; Antisense; TACCAAGCCAATCGTAGACCCCTGT
>probe:Drosophila_2:1638901_at:720:595; Interrogation_Position=883; Antisense; TGTGCCGAACCAACGGAACCAACTG
>probe:Drosophila_2:1638901_at:34:221; Interrogation_Position=908; Antisense; AAGTGGATGCTAGCTCTTCACCGGA
>probe:Drosophila_2:1638901_at:103:119; Interrogation_Position=919; Antisense; AGCTCTTCACCGGATACAGCAAAGG
>probe:Drosophila_2:1638901_at:227:169; Interrogation_Position=939; Antisense; AAAGGATGGCTATGACGACGTAAAT
>probe:Drosophila_2:1638901_at:494:491; Interrogation_Position=958; Antisense; GTAAATCTCTCGACAGTACCGACAA
>probe:Drosophila_2:1638901_at:300:455; Interrogation_Position=990; Antisense; GATAACAGCCGGACCAACACCATTA

Paste this into a BLAST search page for me
ATTACCAACTGCTCCCGGAACTGTGGAACTTCGGCCACTGCTATAGCAGAGAAGCTCCTGCAGCAGAGGCGCCTGAGAAGAGGCTGCACCGGAAGCCGCCTCCCGCTGAAGAAGCTCCCGCAGAAAAGAAGCTCCCGCAGCTGAGTAGATGCTGTGTTTATTAATTTTCCCTTAGTACCAAGCCAATCGTAGACCCCTGTTGTGCCGAACCAACGGAACCAACTGAAGTGGATGCTAGCTCTTCACCGGAAGCTCTTCACCGGATACAGCAAAGGAAAGGATGGCTATGACGACGTAAATGTAAATCTCTCGACAGTACCGACAAGATAACAGCCGGACCAACACCATTA

Full Affymetrix probeset data:

Annotations for 1638901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720