FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638902_at:

>probe:Drosophila_2:1638902_at:248:529; Interrogation_Position=1075; Antisense; GGGATTCCGCATTACGGGATACTTT
>probe:Drosophila_2:1638902_at:642:179; Interrogation_Position=1108; Antisense; AAACATGGAGGCCTTCTCATCGATT
>probe:Drosophila_2:1638902_at:663:713; Interrogation_Position=1121; Antisense; TTCTCATCGATTGTTCGCACGGCGA
>probe:Drosophila_2:1638902_at:3:443; Interrogation_Position=1144; Antisense; GATGTCCTACATCACAATGCTGAGA
>probe:Drosophila_2:1638902_at:450:703; Interrogation_Position=1230; Antisense; TTATTGCTGAGCATGCGTTGCCGTA
>probe:Drosophila_2:1638902_at:662:325; Interrogation_Position=1244; Antisense; GCGTTGCCGTACGACATTTAACAAT
>probe:Drosophila_2:1638902_at:315:649; Interrogation_Position=775; Antisense; TCAGTGCTACCAACCGATTATCTGC
>probe:Drosophila_2:1638902_at:473:93; Interrogation_Position=804; Antisense; AGTTCTTCATTTCATCTCTGCAACT
>probe:Drosophila_2:1638902_at:154:147; Interrogation_Position=826; Antisense; ACTCTGCATGCTGGGATATCTGTTC
>probe:Drosophila_2:1638902_at:417:23; Interrogation_Position=841; Antisense; ATATCTGTTCTCCATTACTTTTGCC
>probe:Drosophila_2:1638902_at:9:101; Interrogation_Position=871; Antisense; AGAGGGCGTCTACTATGCCTCATTC
>probe:Drosophila_2:1638902_at:108:317; Interrogation_Position=887; Antisense; GCCTCATTCATAGCCACAATCATTA
>probe:Drosophila_2:1638902_at:268:101; Interrogation_Position=957; Antisense; AGAGTGCCAGCTTCGAGTGGGCCAT
>probe:Drosophila_2:1638902_at:136:39; Interrogation_Position=980; Antisense; ATCTACGACAGTCCGTGGCACGAGA

Paste this into a BLAST search page for me
GGGATTCCGCATTACGGGATACTTTAAACATGGAGGCCTTCTCATCGATTTTCTCATCGATTGTTCGCACGGCGAGATGTCCTACATCACAATGCTGAGATTATTGCTGAGCATGCGTTGCCGTAGCGTTGCCGTACGACATTTAACAATTCAGTGCTACCAACCGATTATCTGCAGTTCTTCATTTCATCTCTGCAACTACTCTGCATGCTGGGATATCTGTTCATATCTGTTCTCCATTACTTTTGCCAGAGGGCGTCTACTATGCCTCATTCGCCTCATTCATAGCCACAATCATTAAGAGTGCCAGCTTCGAGTGGGCCATATCTACGACAGTCCGTGGCACGAGA

Full Affymetrix probeset data:

Annotations for 1638902_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720