Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638908_at:

>probe:Drosophila_2:1638908_at:75:625; Interrogation_Position=2801; Antisense; TGCCTTCTAATTCTGTATTGCCACC
>probe:Drosophila_2:1638908_at:351:651; Interrogation_Position=3193; Antisense; TCACCGATTCAAATTGGACGTCCAG
>probe:Drosophila_2:1638908_at:438:723; Interrogation_Position=3206; Antisense; TTGGACGTCCAGTAGGATCACAGAA
>probe:Drosophila_2:1638908_at:187:455; Interrogation_Position=3221; Antisense; GATCACAGAAGCCTGCTAGTTCCAA
>probe:Drosophila_2:1638908_at:704:315; Interrogation_Position=3231; Antisense; GCCTGCTAGTTCCAAAATACGTCCT
>probe:Drosophila_2:1638908_at:146:677; Interrogation_Position=3237; Antisense; TAGTTCCAAAATACGTCCTCCACCA
>probe:Drosophila_2:1638908_at:175:715; Interrogation_Position=3264; Antisense; TTCTGAACCTCAAAACCCGGACAAT
>probe:Drosophila_2:1638908_at:254:651; Interrogation_Position=3273; Antisense; TCAAAACCCGGACAATGTGCCCAAG
>probe:Drosophila_2:1638908_at:696:559; Interrogation_Position=3282; Antisense; GGACAATGTGCCCAAGCAGCCAGTT
>probe:Drosophila_2:1638908_at:613:597; Interrogation_Position=3288; Antisense; TGTGCCCAAGCAGCCAGTTAAAAAT
>probe:Drosophila_2:1638908_at:383:311; Interrogation_Position=3300; Antisense; GCCAGTTAAAAATCCACCTGCAGGA
>probe:Drosophila_2:1638908_at:459:45; Interrogation_Position=3311; Antisense; ATCCACCTGCAGGAGGAAACTTAAA
>probe:Drosophila_2:1638908_at:503:491; Interrogation_Position=3337; Antisense; GTAAATGACATACGCATCGACCGTC
>probe:Drosophila_2:1638908_at:672:269; Interrogation_Position=3345; Antisense; CATACGCATCGACCGTCCCAATTAA

Paste this into a BLAST search page for me
TGCCTTCTAATTCTGTATTGCCACCTCACCGATTCAAATTGGACGTCCAGTTGGACGTCCAGTAGGATCACAGAAGATCACAGAAGCCTGCTAGTTCCAAGCCTGCTAGTTCCAAAATACGTCCTTAGTTCCAAAATACGTCCTCCACCATTCTGAACCTCAAAACCCGGACAATTCAAAACCCGGACAATGTGCCCAAGGGACAATGTGCCCAAGCAGCCAGTTTGTGCCCAAGCAGCCAGTTAAAAATGCCAGTTAAAAATCCACCTGCAGGAATCCACCTGCAGGAGGAAACTTAAAGTAAATGACATACGCATCGACCGTCCATACGCATCGACCGTCCCAATTAA

Full Affymetrix probeset data:

Annotations for 1638908_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime