Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638910_at:

>probe:Drosophila_2:1638910_at:530:69; Interrogation_Position=523; Antisense; AGGCCAACTACTGCTCGAAGATCCG
>probe:Drosophila_2:1638910_at:634:575; Interrogation_Position=549; Antisense; GGCCGGGAGGACTTCTTTGAGAACT
>probe:Drosophila_2:1638910_at:386:643; Interrogation_Position=574; Antisense; TCTCCACCGTGGTCTGTGCGGATGA
>probe:Drosophila_2:1638910_at:192:57; Interrogation_Position=595; Antisense; ATGATCCGGAGTTGCGGGCACCCAA
>probe:Drosophila_2:1638910_at:580:135; Interrogation_Position=631; Antisense; ACGTCTACCTGATTGCCATGTCGAG
>probe:Drosophila_2:1638910_at:298:631; Interrogation_Position=701; Antisense; TCCCAAAGGAGTTCAGGCGGCGAGC
>probe:Drosophila_2:1638910_at:216:405; Interrogation_Position=733; Antisense; GACTGCCCGTCATAATGTTGGCCGA
>probe:Drosophila_2:1638910_at:93:715; Interrogation_Position=766; Antisense; TTCCCTGCTGTTGGTCCGAATTGGC
>probe:Drosophila_2:1638910_at:730:721; Interrogation_Position=795; Antisense; TTGCGCTTCGAGTACCTGGACGACT
>probe:Drosophila_2:1638910_at:100:417; Interrogation_Position=822; Antisense; GAGCCGGAGATGTATAATTTGCCCC
>probe:Drosophila_2:1638910_at:724:15; Interrogation_Position=848; Antisense; ATTTACGGACCCTGCGCCCAAGAGG
>probe:Drosophila_2:1638910_at:417:295; Interrogation_Position=864; Antisense; CCCAAGAGGCGATCGAGTCGTCGGC
>probe:Drosophila_2:1638910_at:194:501; Interrogation_Position=883; Antisense; GTCGGCGCACGAGATACAGTCAAAG
>probe:Drosophila_2:1638910_at:312:215; Interrogation_Position=905; Antisense; AAGATTGACCGTAATCCGGGCAAGA

Paste this into a BLAST search page for me
AGGCCAACTACTGCTCGAAGATCCGGGCCGGGAGGACTTCTTTGAGAACTTCTCCACCGTGGTCTGTGCGGATGAATGATCCGGAGTTGCGGGCACCCAAACGTCTACCTGATTGCCATGTCGAGTCCCAAAGGAGTTCAGGCGGCGAGCGACTGCCCGTCATAATGTTGGCCGATTCCCTGCTGTTGGTCCGAATTGGCTTGCGCTTCGAGTACCTGGACGACTGAGCCGGAGATGTATAATTTGCCCCATTTACGGACCCTGCGCCCAAGAGGCCCAAGAGGCGATCGAGTCGTCGGCGTCGGCGCACGAGATACAGTCAAAGAAGATTGACCGTAATCCGGGCAAGA

Full Affymetrix probeset data:

Annotations for 1638910_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime