FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638911_at:

>probe:Drosophila_2:1638911_at:198:651; Interrogation_Position=19; Antisense; TCACGACGCGACAAATTGCTGCAGC
>probe:Drosophila_2:1638911_at:205:377; Interrogation_Position=201; Antisense; GAACCTAAGACTCCTCCAGAAACTG
>probe:Drosophila_2:1638911_at:49:391; Interrogation_Position=219; Antisense; GAAACTGGGCGACATCATGCGCACC
>probe:Drosophila_2:1638911_at:617:323; Interrogation_Position=246; Antisense; GCGCATCAACAATCTCTGGCTGGAG
>probe:Drosophila_2:1638911_at:363:325; Interrogation_Position=273; Antisense; GCGGCCCAATTTTCTTAACCGCGAG
>probe:Drosophila_2:1638911_at:621:657; Interrogation_Position=288; Antisense; TAACCGCGAGAAGCTTTTTGCCACC
>probe:Drosophila_2:1638911_at:422:307; Interrogation_Position=326; Antisense; GCCTCCCGGAAGTGGTCACCATTTA
>probe:Drosophila_2:1638911_at:286:7; Interrogation_Position=33; Antisense; ATTGCTGCAGCAGCCGTGGGAGCAA
>probe:Drosophila_2:1638911_at:577:527; Interrogation_Position=366; Antisense; GGGACCACTTATCTATGGCATGCTG
>probe:Drosophila_2:1638911_at:518:303; Interrogation_Position=475; Antisense; CCTTGGGCGCCCGAGAGAAAGTCCT
>probe:Drosophila_2:1638911_at:646:89; Interrogation_Position=522; Antisense; AGTAAAGCCGCATCGATGCTACCAC
>probe:Drosophila_2:1638911_at:534:445; Interrogation_Position=536; Antisense; GATGCTACCACTGCGGATCTGTAAA
>probe:Drosophila_2:1638911_at:91:491; Interrogation_Position=576; Antisense; GTACTTCGAGGAATTCTCCTACTCT
>probe:Drosophila_2:1638911_at:410:279; Interrogation_Position=594; Antisense; CTACTCTTACTCCTACGACGAATGA

Paste this into a BLAST search page for me
TCACGACGCGACAAATTGCTGCAGCGAACCTAAGACTCCTCCAGAAACTGGAAACTGGGCGACATCATGCGCACCGCGCATCAACAATCTCTGGCTGGAGGCGGCCCAATTTTCTTAACCGCGAGTAACCGCGAGAAGCTTTTTGCCACCGCCTCCCGGAAGTGGTCACCATTTAATTGCTGCAGCAGCCGTGGGAGCAAGGGACCACTTATCTATGGCATGCTGCCTTGGGCGCCCGAGAGAAAGTCCTAGTAAAGCCGCATCGATGCTACCACGATGCTACCACTGCGGATCTGTAAAGTACTTCGAGGAATTCTCCTACTCTCTACTCTTACTCCTACGACGAATGA

Full Affymetrix probeset data:

Annotations for 1638911_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720