FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638913_at:

>probe:Drosophila_2:1638913_at:673:483; Interrogation_Position=3405; Antisense; GTATCCGTCGTGGTATTGGACCAGC
>probe:Drosophila_2:1638913_at:247:537; Interrogation_Position=3438; Antisense; GGTACAATGTCGGATTCCCAACCAT
>probe:Drosophila_2:1638913_at:658:21; Interrogation_Position=3461; Antisense; ATACATCGACGTCGGACCCATTTCG
>probe:Drosophila_2:1638913_at:531:113; Interrogation_Position=3556; Antisense; AGCACCACGGCGATCATCATCAATC
>probe:Drosophila_2:1638913_at:313:189; Interrogation_Position=3636; Antisense; AACAGTTCTATAATGGCTTTGCCAA
>probe:Drosophila_2:1638913_at:642:341; Interrogation_Position=3651; Antisense; GCTTTGCCAATCGTCCCAAATGGTA
>probe:Drosophila_2:1638913_at:563:217; Interrogation_Position=3683; Antisense; AAGTCAGAGGGACTACTATCCATCC
>probe:Drosophila_2:1638913_at:375:83; Interrogation_Position=3732; Antisense; AGTGGAAGTGTTATCCAGCCGCCCA
>probe:Drosophila_2:1638913_at:352:11; Interrogation_Position=3756; Antisense; ATTCGTCGCGGTTTGCAATCGGCGG
>probe:Drosophila_2:1638913_at:394:105; Interrogation_Position=3800; Antisense; AGACACGGCGGCACTAAGTCAGCAT
>probe:Drosophila_2:1638913_at:604:351; Interrogation_Position=3827; Antisense; GCAGCAATTGCAGCTCCTTCAGCTG
>probe:Drosophila_2:1638913_at:184:647; Interrogation_Position=3881; Antisense; TCATCATCCGCAGCAATCAGGCGAT
>probe:Drosophila_2:1638913_at:639:355; Interrogation_Position=3916; Antisense; GCAACAACAGTCAGTCCGAACAAAT
>probe:Drosophila_2:1638913_at:19:423; Interrogation_Position=3945; Antisense; GAGAATGGCTGCTACCCGGAATATA

Paste this into a BLAST search page for me
GTATCCGTCGTGGTATTGGACCAGCGGTACAATGTCGGATTCCCAACCATATACATCGACGTCGGACCCATTTCGAGCACCACGGCGATCATCATCAATCAACAGTTCTATAATGGCTTTGCCAAGCTTTGCCAATCGTCCCAAATGGTAAAGTCAGAGGGACTACTATCCATCCAGTGGAAGTGTTATCCAGCCGCCCAATTCGTCGCGGTTTGCAATCGGCGGAGACACGGCGGCACTAAGTCAGCATGCAGCAATTGCAGCTCCTTCAGCTGTCATCATCCGCAGCAATCAGGCGATGCAACAACAGTCAGTCCGAACAAATGAGAATGGCTGCTACCCGGAATATA

Full Affymetrix probeset data:

Annotations for 1638913_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720