FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638914_at:

>probe:Drosophila_2:1638914_at:53:109; Interrogation_Position=1590; Antisense; AGAAGCGACGACGTGTCCTGCCGGT
>probe:Drosophila_2:1638914_at:389:251; Interrogation_Position=1630; Antisense; CAAGAGGGAGCCAACTGCTCCGCAT
>probe:Drosophila_2:1638914_at:325:549; Interrogation_Position=1662; Antisense; GGACGAACGCCATCAAACAGACGCC
>probe:Drosophila_2:1638914_at:27:649; Interrogation_Position=1756; Antisense; TCATGCGGTGGGTCATTCTGCTGCA
>probe:Drosophila_2:1638914_at:383:523; Interrogation_Position=1782; Antisense; GGGCGCCAATGTTTAAGGACGCATT
>probe:Drosophila_2:1638914_at:484:657; Interrogation_Position=1795; Antisense; TAAGGACGCATTCGGCGGTGCCAAA
>probe:Drosophila_2:1638914_at:106:313; Interrogation_Position=1814; Antisense; GCCAAAATCGGCACCGTGAACGTGA
>probe:Drosophila_2:1638914_at:533:511; Interrogation_Position=1835; Antisense; GTGAACGGCGTCAATGTCATTGGCC
>probe:Drosophila_2:1638914_at:359:3; Interrogation_Position=1853; Antisense; ATTGGCCTGCATCCTGCGCAAAGGA
>probe:Drosophila_2:1638914_at:258:55; Interrogation_Position=1901; Antisense; ATGAATGAGGCGGACCCGACGCCGA
>probe:Drosophila_2:1638914_at:30:439; Interrogation_Position=1924; Antisense; GATGTCGGCGTTGACCTACCAAGTG
>probe:Drosophila_2:1638914_at:67:469; Interrogation_Position=1933; Antisense; GTTGACCTACCAAGTGCCTATGCTC
>probe:Drosophila_2:1638914_at:441:611; Interrogation_Position=2037; Antisense; TGACGTCATCGGCATCGCTAACAGG
>probe:Drosophila_2:1638914_at:148:533; Interrogation_Position=2111; Antisense; GGTCCCTCGTTCATCAGTTTAATTC

Paste this into a BLAST search page for me
AGAAGCGACGACGTGTCCTGCCGGTCAAGAGGGAGCCAACTGCTCCGCATGGACGAACGCCATCAAACAGACGCCTCATGCGGTGGGTCATTCTGCTGCAGGGCGCCAATGTTTAAGGACGCATTTAAGGACGCATTCGGCGGTGCCAAAGCCAAAATCGGCACCGTGAACGTGAGTGAACGGCGTCAATGTCATTGGCCATTGGCCTGCATCCTGCGCAAAGGAATGAATGAGGCGGACCCGACGCCGAGATGTCGGCGTTGACCTACCAAGTGGTTGACCTACCAAGTGCCTATGCTCTGACGTCATCGGCATCGCTAACAGGGGTCCCTCGTTCATCAGTTTAATTC

Full Affymetrix probeset data:

Annotations for 1638914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720