FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638915_at:

>probe:Drosophila_2:1638915_at:612:237; Interrogation_Position=1445; Antisense; AATCGGGCGAGTTCCGGCTCATCGA
>probe:Drosophila_2:1638915_at:300:631; Interrogation_Position=1463; Antisense; TCATCGACCCGGACGAGGTGGCCAG
>probe:Drosophila_2:1638915_at:221:417; Interrogation_Position=1498; Antisense; GAGCGCAAGGCCAAACCGAACATGA
>probe:Drosophila_2:1638915_at:530:613; Interrogation_Position=1520; Antisense; TGAACTACGACAAGCTGAGCCGGGC
>probe:Drosophila_2:1638915_at:457:603; Interrogation_Position=1535; Antisense; TGAGCCGGGCACTCAGGTACTACTA
>probe:Drosophila_2:1638915_at:221:133; Interrogation_Position=1586; Antisense; ACGGAAAGCGGTATGCCTACAAGTT
>probe:Drosophila_2:1638915_at:137:217; Interrogation_Position=1606; Antisense; AAGTTTGACTTCCACGGTCTGATGG
>probe:Drosophila_2:1638915_at:276:75; Interrogation_Position=1656; Antisense; AGGAGATCCGGCCTCCAGTATGCTG
>probe:Drosophila_2:1638915_at:590:483; Interrogation_Position=1673; Antisense; GTATGCTGGGTTCCTACAATCACCA
>probe:Drosophila_2:1638915_at:263:241; Interrogation_Position=1918; Antisense; AATTTTACTGCTCCATTCCAAGGTG
>probe:Drosophila_2:1638915_at:380:9; Interrogation_Position=1932; Antisense; ATTCCAAGGTGGGACAGCCGGCGTA
>probe:Drosophila_2:1638915_at:682:73; Interrogation_Position=1966; Antisense; AGGACGTCCACATCTTCTGCGGGAA
>probe:Drosophila_2:1638915_at:52:643; Interrogation_Position=1981; Antisense; TCTGCGGGAAACTACGACCAGGGCC
>probe:Drosophila_2:1638915_at:82:633; Interrogation_Position=2013; Antisense; TCCCACCACAAATGCATTCAACTGA

Paste this into a BLAST search page for me
AATCGGGCGAGTTCCGGCTCATCGATCATCGACCCGGACGAGGTGGCCAGGAGCGCAAGGCCAAACCGAACATGATGAACTACGACAAGCTGAGCCGGGCTGAGCCGGGCACTCAGGTACTACTAACGGAAAGCGGTATGCCTACAAGTTAAGTTTGACTTCCACGGTCTGATGGAGGAGATCCGGCCTCCAGTATGCTGGTATGCTGGGTTCCTACAATCACCAAATTTTACTGCTCCATTCCAAGGTGATTCCAAGGTGGGACAGCCGGCGTAAGGACGTCCACATCTTCTGCGGGAATCTGCGGGAAACTACGACCAGGGCCTCCCACCACAAATGCATTCAACTGA

Full Affymetrix probeset data:

Annotations for 1638915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720