Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638916_at:

>probe:Drosophila_2:1638916_at:357:115; Interrogation_Position=113; Antisense; AGCAGGAACTTCTCGAGCGGCCTTG
>probe:Drosophila_2:1638916_at:683:581; Interrogation_Position=141; Antisense; TGGCGCCACCAACATTGAGCAGCAG
>probe:Drosophila_2:1638916_at:514:617; Interrogation_Position=180; Antisense; TGCAGATCGGCTCCAAATCGCAGCA
>probe:Drosophila_2:1638916_at:332:165; Interrogation_Position=194; Antisense; AAATCGCAGCAGTCCAGGTTGCAGC
>probe:Drosophila_2:1638916_at:282:629; Interrogation_Position=219; Antisense; TCCACTGCAACCACAGGCATCAATA
>probe:Drosophila_2:1638916_at:22:109; Interrogation_Position=278; Antisense; AGAAGATCCAAGCATCCCCTTCGAG
>probe:Drosophila_2:1638916_at:86:673; Interrogation_Position=309; Antisense; TACCCACGCTATGCAGGACTTAGAG
>probe:Drosophila_2:1638916_at:199:101; Interrogation_Position=330; Antisense; AGAGGACACTCCGATTATCACCATC
>probe:Drosophila_2:1638916_at:157:485; Interrogation_Position=35; Antisense; GTAGAAGTAGCTGCCCGATCTGGGA
>probe:Drosophila_2:1638916_at:408:137; Interrogation_Position=356; Antisense; ACGACGAGGTTCTTCACGACGAGGA
>probe:Drosophila_2:1638916_at:572:193; Interrogation_Position=391; Antisense; AACTCCCAGGTATCCGCTGATGGTG
>probe:Drosophila_2:1638916_at:684:223; Interrogation_Position=67; Antisense; AAGGAGTCTGGCTCCAGACCATACA
>probe:Drosophila_2:1638916_at:256:103; Interrogation_Position=82; Antisense; AGACCATACAATCCCGAGGGCCGCT
>probe:Drosophila_2:1638916_at:681:433; Interrogation_Position=97; Antisense; GAGGGCCGCTACGTTCAGCAGGAAC

Paste this into a BLAST search page for me
AGCAGGAACTTCTCGAGCGGCCTTGTGGCGCCACCAACATTGAGCAGCAGTGCAGATCGGCTCCAAATCGCAGCAAAATCGCAGCAGTCCAGGTTGCAGCTCCACTGCAACCACAGGCATCAATAAGAAGATCCAAGCATCCCCTTCGAGTACCCACGCTATGCAGGACTTAGAGAGAGGACACTCCGATTATCACCATCGTAGAAGTAGCTGCCCGATCTGGGAACGACGAGGTTCTTCACGACGAGGAAACTCCCAGGTATCCGCTGATGGTGAAGGAGTCTGGCTCCAGACCATACAAGACCATACAATCCCGAGGGCCGCTGAGGGCCGCTACGTTCAGCAGGAAC

Full Affymetrix probeset data:

Annotations for 1638916_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime