FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638919_at:

>probe:Drosophila_2:1638919_at:459:409; Interrogation_Position=1012; Antisense; GACGAGGACTTCTTCAGACGCATCA
>probe:Drosophila_2:1638919_at:477:713; Interrogation_Position=1024; Antisense; TTCAGACGCATCAAGCCCGAGAATG
>probe:Drosophila_2:1638919_at:483:583; Interrogation_Position=1047; Antisense; TGGCATTGAACGCATTCTGGGCAAG
>probe:Drosophila_2:1638919_at:282:723; Interrogation_Position=1091; Antisense; TTGAATTCCTTCTGCGCTACGAGAA
>probe:Drosophila_2:1638919_at:487:227; Interrogation_Position=1118; Antisense; AAGGCGGACTCTTCTGGCAATCGGA
>probe:Drosophila_2:1638919_at:711:335; Interrogation_Position=1170; Antisense; GCTGCTCAAGGCCTACGAAATGAAT
>probe:Drosophila_2:1638919_at:457:123; Interrogation_Position=1211; Antisense; AGCGCTTGATGCATCACGTTGCCAA
>probe:Drosophila_2:1638919_at:377:499; Interrogation_Position=1244; Antisense; GTCTGCGACAGCGATACACGGATTT
>probe:Drosophila_2:1638919_at:632:153; Interrogation_Position=1259; Antisense; ACACGGATTTCTAGTAGCGGTTACT
>probe:Drosophila_2:1638919_at:645:679; Interrogation_Position=1291; Antisense; TAGGTTCATAATTAGGTTCCACATA
>probe:Drosophila_2:1638919_at:51:453; Interrogation_Position=850; Antisense; GATCTGGCCAAGACAATCGCCGAGG
>probe:Drosophila_2:1638919_at:62:79; Interrogation_Position=878; Antisense; AGGATTACCTCAAGCAGCACCCGTT
>probe:Drosophila_2:1638919_at:12:469; Interrogation_Position=900; Antisense; GTTGACATACGTGCAGCGCGTCGAA
>probe:Drosophila_2:1638919_at:483:441; Interrogation_Position=946; Antisense; GATGGACTGCTCAGCATCGAGGATA

Paste this into a BLAST search page for me
GACGAGGACTTCTTCAGACGCATCATTCAGACGCATCAAGCCCGAGAATGTGGCATTGAACGCATTCTGGGCAAGTTGAATTCCTTCTGCGCTACGAGAAAAGGCGGACTCTTCTGGCAATCGGAGCTGCTCAAGGCCTACGAAATGAATAGCGCTTGATGCATCACGTTGCCAAGTCTGCGACAGCGATACACGGATTTACACGGATTTCTAGTAGCGGTTACTTAGGTTCATAATTAGGTTCCACATAGATCTGGCCAAGACAATCGCCGAGGAGGATTACCTCAAGCAGCACCCGTTGTTGACATACGTGCAGCGCGTCGAAGATGGACTGCTCAGCATCGAGGATA

Full Affymetrix probeset data:

Annotations for 1638919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720