FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638923_at:

>probe:Drosophila_2:1638923_at:470:141; Interrogation_Position=100; Antisense; ACGGATCTGTGGGTGGTCATCGACA
>probe:Drosophila_2:1638923_at:404:215; Interrogation_Position=145; Antisense; AAGTTCCGTCTCGAGGCAAGTGGCG
>probe:Drosophila_2:1638923_at:49:349; Interrogation_Position=172; Antisense; GCAGATTGTTGCATCCCGGTGGCGA
>probe:Drosophila_2:1638923_at:305:251; Interrogation_Position=233; Antisense; CAAGGCCTTCAATGACGTGGGTCAC
>probe:Drosophila_2:1638923_at:17:667; Interrogation_Position=286; Antisense; TACTACATTGGTGACCTGGCTGCTG
>probe:Drosophila_2:1638923_at:76:287; Interrogation_Position=301; Antisense; CTGGCTGCTGCGGACATCAAGAAGA
>probe:Drosophila_2:1638923_at:470:387; Interrogation_Position=324; Antisense; GAAAAGCCCAATTAGCTGCCGTCAT
>probe:Drosophila_2:1638923_at:460:39; Interrogation_Position=382; Antisense; ATCTCGCTGGTCTATGTGATCCGAC
>probe:Drosophila_2:1638923_at:438:449; Interrogation_Position=399; Antisense; GATCCGACGCGGTGTGGCCAGAAAC
>probe:Drosophila_2:1638923_at:487:309; Interrogation_Position=415; Antisense; GCCAGAAACTAGTCTGCGGCCGGAC
>probe:Drosophila_2:1638923_at:482:329; Interrogation_Position=430; Antisense; GCGGCCGGACTGCATTACGAGATTC
>probe:Drosophila_2:1638923_at:398:385; Interrogation_Position=477; Antisense; GAACATCAATTTCCTCACACATTTG
>probe:Drosophila_2:1638923_at:436:357; Interrogation_Position=56; Antisense; GCAAGGAAATCCGTTTGGCCACCGT
>probe:Drosophila_2:1638923_at:280:387; Interrogation_Position=85; Antisense; GAACACAACAAAGCCACGGATCTGT

Paste this into a BLAST search page for me
ACGGATCTGTGGGTGGTCATCGACAAAGTTCCGTCTCGAGGCAAGTGGCGGCAGATTGTTGCATCCCGGTGGCGACAAGGCCTTCAATGACGTGGGTCACTACTACATTGGTGACCTGGCTGCTGCTGGCTGCTGCGGACATCAAGAAGAGAAAAGCCCAATTAGCTGCCGTCATATCTCGCTGGTCTATGTGATCCGACGATCCGACGCGGTGTGGCCAGAAACGCCAGAAACTAGTCTGCGGCCGGACGCGGCCGGACTGCATTACGAGATTCGAACATCAATTTCCTCACACATTTGGCAAGGAAATCCGTTTGGCCACCGTGAACACAACAAAGCCACGGATCTGT

Full Affymetrix probeset data:

Annotations for 1638923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720