FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638924_at:

>probe:Drosophila_2:1638924_at:235:119; Interrogation_Position=108; Antisense; AGCTCCTCTTGGTTGCAAGTGCAAC
>probe:Drosophila_2:1638924_at:245:219; Interrogation_Position=124; Antisense; AAGTGCAACGGCTCCTAGTTGGCGA
>probe:Drosophila_2:1638924_at:497:633; Interrogation_Position=180; Antisense; TCGCTGTCCCAGTGTTTTTGTGTTT
>probe:Drosophila_2:1638924_at:493:727; Interrogation_Position=197; Antisense; TTGTGTTTTTGCCATTCGGTCGCTT
>probe:Drosophila_2:1638924_at:666:635; Interrogation_Position=212; Antisense; TCGGTCGCTTTTGGTTCGGTTCGCT
>probe:Drosophila_2:1638924_at:43:155; Interrogation_Position=310; Antisense; ACAGAATGGCTAAGGCAGCTCCTCC
>probe:Drosophila_2:1638924_at:645:275; Interrogation_Position=445; Antisense; CTTTGCGAATCACTTTTTTGGTTGC
>probe:Drosophila_2:1638924_at:7:591; Interrogation_Position=463; Antisense; TGGTTGCATGACCAACGCACAGCAC
>probe:Drosophila_2:1638924_at:529:257; Interrogation_Position=490; Antisense; CACACCGTGGGCTTGCGTAAGTTCG
>probe:Drosophila_2:1638924_at:477:199; Interrogation_Position=531; Antisense; AACGCGGCGTATGAGCAATGTTTAA
>probe:Drosophila_2:1638924_at:101:663; Interrogation_Position=553; Antisense; TAAAGGGTGCTACCTGACAGAGTTC
>probe:Drosophila_2:1638924_at:612:399; Interrogation_Position=568; Antisense; GACAGAGTTCAGTCCACTCACCTGA
>probe:Drosophila_2:1638924_at:380:131; Interrogation_Position=587; Antisense; ACCTGACAAACAACTGCTCCTGATT
>probe:Drosophila_2:1638924_at:450:175; Interrogation_Position=88; Antisense; AAACGGCCATCAATGGAGGCAGCTC

Paste this into a BLAST search page for me
AGCTCCTCTTGGTTGCAAGTGCAACAAGTGCAACGGCTCCTAGTTGGCGATCGCTGTCCCAGTGTTTTTGTGTTTTTGTGTTTTTGCCATTCGGTCGCTTTCGGTCGCTTTTGGTTCGGTTCGCTACAGAATGGCTAAGGCAGCTCCTCCCTTTGCGAATCACTTTTTTGGTTGCTGGTTGCATGACCAACGCACAGCACCACACCGTGGGCTTGCGTAAGTTCGAACGCGGCGTATGAGCAATGTTTAATAAAGGGTGCTACCTGACAGAGTTCGACAGAGTTCAGTCCACTCACCTGAACCTGACAAACAACTGCTCCTGATTAAACGGCCATCAATGGAGGCAGCTC

Full Affymetrix probeset data:

Annotations for 1638924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720