FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638925_at:

>probe:Drosophila_2:1638925_at:672:189; Interrogation_Position=111; Antisense; AACATGCCAGTGCTCGCTAGTTTGT
>probe:Drosophila_2:1638925_at:104:421; Interrogation_Position=164; Antisense; GAGCAGCTCACCTAATGTCCATAGA
>probe:Drosophila_2:1638925_at:308:377; Interrogation_Position=197; Antisense; GAAGCCTGTTGTCTAACTTTGCTAG
>probe:Drosophila_2:1638925_at:262:677; Interrogation_Position=219; Antisense; TAGAACTTCCTCTGCACAACAGCAA
>probe:Drosophila_2:1638925_at:472:17; Interrogation_Position=346; Antisense; ATTTAAGCAAGCACTGGTCGATGGG
>probe:Drosophila_2:1638925_at:643:465; Interrogation_Position=434; Antisense; GTTGGCAAAGATGGTCGACTGTCAG
>probe:Drosophila_2:1638925_at:65:295; Interrogation_Position=449; Antisense; CGACTGTCAGACGTGGAAGGCTACT
>probe:Drosophila_2:1638925_at:377:227; Interrogation_Position=465; Antisense; AAGGCTACTGTCTGGCAGGCAGTCA
>probe:Drosophila_2:1638925_at:607:567; Interrogation_Position=478; Antisense; GGCAGGCAGTCAAGTGCTCACGACT
>probe:Drosophila_2:1638925_at:19:405; Interrogation_Position=506; Antisense; GACTCCGGACTTTCGAGCAAGAACA
>probe:Drosophila_2:1638925_at:56:351; Interrogation_Position=568; Antisense; GCAGCTGAGCTCCTTTTTGTTATTT
>probe:Drosophila_2:1638925_at:577:121; Interrogation_Position=610; Antisense; CGTCGGGAACGGTGTACTGTATATA
>probe:Drosophila_2:1638925_at:546:643; Interrogation_Position=640; Antisense; TCTACATGGTAGAGTCGCACTTGGT
>probe:Drosophila_2:1638925_at:418:237; Interrogation_Position=81; Antisense; AATCTGCTGCGGTTGGCGGAAGTTA

Paste this into a BLAST search page for me
AACATGCCAGTGCTCGCTAGTTTGTGAGCAGCTCACCTAATGTCCATAGAGAAGCCTGTTGTCTAACTTTGCTAGTAGAACTTCCTCTGCACAACAGCAAATTTAAGCAAGCACTGGTCGATGGGGTTGGCAAAGATGGTCGACTGTCAGCGACTGTCAGACGTGGAAGGCTACTAAGGCTACTGTCTGGCAGGCAGTCAGGCAGGCAGTCAAGTGCTCACGACTGACTCCGGACTTTCGAGCAAGAACAGCAGCTGAGCTCCTTTTTGTTATTTCGTCGGGAACGGTGTACTGTATATATCTACATGGTAGAGTCGCACTTGGTAATCTGCTGCGGTTGGCGGAAGTTA

Full Affymetrix probeset data:

Annotations for 1638925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720