Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638927_at:

>probe:Drosophila_2:1638927_at:325:475; Interrogation_Position=1054; Antisense; GTTATCTGCGGTCAATCGATGTCTA
>probe:Drosophila_2:1638927_at:578:3; Interrogation_Position=1112; Antisense; ATTGACCTTCTTGTTAATCGATGGA
>probe:Drosophila_2:1638927_at:65:651; Interrogation_Position=1152; Antisense; TAATTCTTACCGCAGATTTCTAACC
>probe:Drosophila_2:1638927_at:515:459; Interrogation_Position=1166; Antisense; GATTTCTAACCTATCACTCGCGTAT
>probe:Drosophila_2:1638927_at:40:301; Interrogation_Position=1192; Antisense; CGCCATCCTAGCTTACGTGTACAAA
>probe:Drosophila_2:1638927_at:486:83; Interrogation_Position=1222; Antisense; AGTGGTTAATGTTTGGCGCCTGGTT
>probe:Drosophila_2:1638927_at:680:653; Interrogation_Position=1256; Antisense; TAATCCTACTCTATGACTCGTGTTC
>probe:Drosophila_2:1638927_at:674:131; Interrogation_Position=1271; Antisense; ACTCGTGTTCGCGTTCGGGACGTAT
>probe:Drosophila_2:1638927_at:123:595; Interrogation_Position=784; Antisense; TGGGCGTCAGTCTCTATCTGACCTT
>probe:Drosophila_2:1638927_at:309:261; Interrogation_Position=827; Antisense; CACCGCCTCGTCGTAGTAATTTTAG
>probe:Drosophila_2:1638927_at:143:241; Interrogation_Position=862; Antisense; AATAGCCAATGATCTTAGCCCAAAT
>probe:Drosophila_2:1638927_at:218:477; Interrogation_Position=893; Antisense; GTTATAGAAGCCTGTCCATTCCAAT
>probe:Drosophila_2:1638927_at:312:505; Interrogation_Position=906; Antisense; GTCCATTCCAATTTCGTGAGTTGAT
>probe:Drosophila_2:1638927_at:640:105; Interrogation_Position=976; Antisense; AGAAAGCTGCAGATTACGCACTAAT

Paste this into a BLAST search page for me
GTTATCTGCGGTCAATCGATGTCTAATTGACCTTCTTGTTAATCGATGGATAATTCTTACCGCAGATTTCTAACCGATTTCTAACCTATCACTCGCGTATCGCCATCCTAGCTTACGTGTACAAAAGTGGTTAATGTTTGGCGCCTGGTTTAATCCTACTCTATGACTCGTGTTCACTCGTGTTCGCGTTCGGGACGTATTGGGCGTCAGTCTCTATCTGACCTTCACCGCCTCGTCGTAGTAATTTTAGAATAGCCAATGATCTTAGCCCAAATGTTATAGAAGCCTGTCCATTCCAATGTCCATTCCAATTTCGTGAGTTGATAGAAAGCTGCAGATTACGCACTAAT

Full Affymetrix probeset data:

Annotations for 1638927_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime