FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638928_at:

>probe:Drosophila_2:1638928_at:11:519; Interrogation_Position=1013; Antisense; GTGGGCACATGCTCATCCTGGCGGA
>probe:Drosophila_2:1638928_at:220:609; Interrogation_Position=1091; Antisense; TGAGCACCTACGTGGCCTGTTGGAA
>probe:Drosophila_2:1638928_at:450:41; Interrogation_Position=1148; Antisense; ATCGAGATGGCCTGGGTTCTTAGTA
>probe:Drosophila_2:1638928_at:436:701; Interrogation_Position=1164; Antisense; TTCTTAGTAGCCCAGTCATTTCACT
>probe:Drosophila_2:1638928_at:347:645; Interrogation_Position=1179; Antisense; TCATTTCACTCACATTCTACATCAA
>probe:Drosophila_2:1638928_at:512:175; Interrogation_Position=732; Antisense; AAACGCGCTGTATAGATTACTCGAT
>probe:Drosophila_2:1638928_at:79:215; Interrogation_Position=763; Antisense; AAGAGTCTCGTTTCGTATCCCATGA
>probe:Drosophila_2:1638928_at:626:307; Interrogation_Position=821; Antisense; CCATCACCCTATTTGTCCTGATATT
>probe:Drosophila_2:1638928_at:545:551; Interrogation_Position=852; Antisense; GGAGACCTTGTACGATCGCATCTAT
>probe:Drosophila_2:1638928_at:474:643; Interrogation_Position=872; Antisense; TCTATTATCTTTGCTTTCTCTTGGG
>probe:Drosophila_2:1638928_at:691:645; Interrogation_Position=890; Antisense; TCTTGGGCATCACCGTGCAGACATA
>probe:Drosophila_2:1638928_at:509:349; Interrogation_Position=906; Antisense; GCAGACATATCCATTGTGCTACTAT
>probe:Drosophila_2:1638928_at:125:695; Interrogation_Position=952; Antisense; TTTGCTGAGCTTCACTATGCGGTAT
>probe:Drosophila_2:1638928_at:507:533; Interrogation_Position=990; Antisense; GGTGGATCAAAGTGCCAGCTATCGT

Paste this into a BLAST search page for me
GTGGGCACATGCTCATCCTGGCGGATGAGCACCTACGTGGCCTGTTGGAAATCGAGATGGCCTGGGTTCTTAGTATTCTTAGTAGCCCAGTCATTTCACTTCATTTCACTCACATTCTACATCAAAAACGCGCTGTATAGATTACTCGATAAGAGTCTCGTTTCGTATCCCATGACCATCACCCTATTTGTCCTGATATTGGAGACCTTGTACGATCGCATCTATTCTATTATCTTTGCTTTCTCTTGGGTCTTGGGCATCACCGTGCAGACATAGCAGACATATCCATTGTGCTACTATTTTGCTGAGCTTCACTATGCGGTATGGTGGATCAAAGTGCCAGCTATCGT

Full Affymetrix probeset data:

Annotations for 1638928_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720