FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638929_at:

>probe:Drosophila_2:1638929_at:335:425; Interrogation_Position=2860; Antisense; GAGATGGCTAGCTCCCTAAACAACG
>probe:Drosophila_2:1638929_at:5:119; Interrogation_Position=2869; Antisense; AGCTCCCTAAACAACGACATCTGAA
>probe:Drosophila_2:1638929_at:525:271; Interrogation_Position=2886; Antisense; CATCTGAATTGTGACTGGTGCCCTA
>probe:Drosophila_2:1638929_at:674:405; Interrogation_Position=2898; Antisense; GACTGGTGCCCTATAAGTTTATATT
>probe:Drosophila_2:1638929_at:519:31; Interrogation_Position=2929; Antisense; ATAATTGATCCTTTGCTTAATGCTA
>probe:Drosophila_2:1638929_at:223:449; Interrogation_Position=2935; Antisense; GATCCTTTGCTTAATGCTATCTCTA
>probe:Drosophila_2:1638929_at:165:53; Interrogation_Position=2948; Antisense; ATGCTATCTCTATAAGTGCTTCAAT
>probe:Drosophila_2:1638929_at:699:503; Interrogation_Position=2963; Antisense; GTGCTTCAATAAACCGGAACTGACT
>probe:Drosophila_2:1638929_at:280:29; Interrogation_Position=2971; Antisense; ATAAACCGGAACTGACTTGATATGT
>probe:Drosophila_2:1638929_at:118:143; Interrogation_Position=2981; Antisense; ACTGACTTGATATGTTATTGCTAAC
>probe:Drosophila_2:1638929_at:114:719; Interrogation_Position=2998; Antisense; TTGCTAACACAAATTCGATCTACGT
>probe:Drosophila_2:1638929_at:64:451; Interrogation_Position=3014; Antisense; GATCTACGTTTTGTAAGCTTACCCT
>probe:Drosophila_2:1638929_at:54:207; Interrogation_Position=3028; Antisense; AAGCTTACCCTAAAATCATGCACAT
>probe:Drosophila_2:1638929_at:626:355; Interrogation_Position=3047; Antisense; GCACATCTTTGTATATAATCTGAAA

Paste this into a BLAST search page for me
GAGATGGCTAGCTCCCTAAACAACGAGCTCCCTAAACAACGACATCTGAACATCTGAATTGTGACTGGTGCCCTAGACTGGTGCCCTATAAGTTTATATTATAATTGATCCTTTGCTTAATGCTAGATCCTTTGCTTAATGCTATCTCTAATGCTATCTCTATAAGTGCTTCAATGTGCTTCAATAAACCGGAACTGACTATAAACCGGAACTGACTTGATATGTACTGACTTGATATGTTATTGCTAACTTGCTAACACAAATTCGATCTACGTGATCTACGTTTTGTAAGCTTACCCTAAGCTTACCCTAAAATCATGCACATGCACATCTTTGTATATAATCTGAAA

Full Affymetrix probeset data:

Annotations for 1638929_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720