FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638933_at:

>probe:Drosophila_2:1638933_at:305:211; Interrogation_Position=2242; Antisense; AAGAAGTTGGCGAGATCTCCCGCAT
>probe:Drosophila_2:1638933_at:719:597; Interrogation_Position=2281; Antisense; TGTCCCTTGTCTTTCACGAGTATTA
>probe:Drosophila_2:1638933_at:499:429; Interrogation_Position=2298; Antisense; GAGTATTACCTCACCTGTCTGTTTC
>probe:Drosophila_2:1638933_at:649:593; Interrogation_Position=2313; Antisense; TGTCTGTTTCGCGACTCCGAGGAGA
>probe:Drosophila_2:1638933_at:138:423; Interrogation_Position=2334; Antisense; GAGACGACCAAGCATTACCTTAGCC
>probe:Drosophila_2:1638933_at:36:277; Interrogation_Position=2352; Antisense; CTTAGCCTCATATGCAACTGGTGGA
>probe:Drosophila_2:1638933_at:158:419; Interrogation_Position=2379; Antisense; GAGCATGCGAACCTGCTTGGTTTTC
>probe:Drosophila_2:1638933_at:304:539; Interrogation_Position=2435; Antisense; GGTTAAAGCCCATTTCATGCTGAAA
>probe:Drosophila_2:1638933_at:85:53; Interrogation_Position=2451; Antisense; ATGCTGAAACCCCTTCATCTGGAGG
>probe:Drosophila_2:1638933_at:653:439; Interrogation_Position=2472; Antisense; GAGGCCAAGCCCAATAATCCAGTCA
>probe:Drosophila_2:1638933_at:646:85; Interrogation_Position=2492; Antisense; AGTCAACGACCTCTCCGAATGGAAA
>probe:Drosophila_2:1638933_at:363:219; Interrogation_Position=2553; Antisense; AAGTCGGCTGTGACAGTTGATCCCA
>probe:Drosophila_2:1638933_at:363:245; Interrogation_Position=2581; Antisense; AATTACTCAACACCGACTTCTTTAG
>probe:Drosophila_2:1638933_at:424:387; Interrogation_Position=2727; Antisense; GAAAAGGCTCGCTGCACAAATTTAG

Paste this into a BLAST search page for me
AAGAAGTTGGCGAGATCTCCCGCATTGTCCCTTGTCTTTCACGAGTATTAGAGTATTACCTCACCTGTCTGTTTCTGTCTGTTTCGCGACTCCGAGGAGAGAGACGACCAAGCATTACCTTAGCCCTTAGCCTCATATGCAACTGGTGGAGAGCATGCGAACCTGCTTGGTTTTCGGTTAAAGCCCATTTCATGCTGAAAATGCTGAAACCCCTTCATCTGGAGGGAGGCCAAGCCCAATAATCCAGTCAAGTCAACGACCTCTCCGAATGGAAAAAGTCGGCTGTGACAGTTGATCCCAAATTACTCAACACCGACTTCTTTAGGAAAAGGCTCGCTGCACAAATTTAG

Full Affymetrix probeset data:

Annotations for 1638933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720