Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638935_at:

>probe:Drosophila_2:1638935_at:174:585; Interrogation_Position=1352; Antisense; TGGAACGACGCGTGGGTCCTGACCA
>probe:Drosophila_2:1638935_at:3:601; Interrogation_Position=1397; Antisense; TGTACGGGATCTGCAGCATCCTGAC
>probe:Drosophila_2:1638935_at:450:531; Interrogation_Position=1436; Antisense; GGGTCATCATCCTGGCTAATTGTGA
>probe:Drosophila_2:1638935_at:535:147; Interrogation_Position=1470; Antisense; ACTAGTACTTGTGATGTTTGCCTTC
>probe:Drosophila_2:1638935_at:367:693; Interrogation_Position=1486; Antisense; TTTGCCTTCATGATGGCCACTACGG
>probe:Drosophila_2:1638935_at:163:141; Interrogation_Position=1507; Antisense; ACGGATATGGGTTTCAGTGGCTACT
>probe:Drosophila_2:1638935_at:364:275; Interrogation_Position=1560; Antisense; CTTCGCGGGATTGCTATCGGGATTG
>probe:Drosophila_2:1638935_at:728:227; Interrogation_Position=1588; Antisense; AATGGAATGGCCCATCTTTCCGGAT
>probe:Drosophila_2:1638935_at:272:641; Interrogation_Position=1638; Antisense; TCTGGTCCACACTGGCAGCAAGGAT
>probe:Drosophila_2:1638935_at:605:465; Interrogation_Position=1689; Antisense; GATTGTCTTTAATACGATGGCCATG
>probe:Drosophila_2:1638935_at:370:579; Interrogation_Position=1707; Antisense; GGCCATGTTGGTATTTGCATTTTGC
>probe:Drosophila_2:1638935_at:71:351; Interrogation_Position=1733; Antisense; GCAGTACGAACCTACAACCTTGGGA
>probe:Drosophila_2:1638935_at:275:203; Interrogation_Position=1748; Antisense; AACCTTGGGATCCTCGTAGCAGAAT
>probe:Drosophila_2:1638935_at:423:195; Interrogation_Position=1779; Antisense; AACTGCATCACCAAGTGCTCAGGAA

Paste this into a BLAST search page for me
TGGAACGACGCGTGGGTCCTGACCATGTACGGGATCTGCAGCATCCTGACGGGTCATCATCCTGGCTAATTGTGAACTAGTACTTGTGATGTTTGCCTTCTTTGCCTTCATGATGGCCACTACGGACGGATATGGGTTTCAGTGGCTACTCTTCGCGGGATTGCTATCGGGATTGAATGGAATGGCCCATCTTTCCGGATTCTGGTCCACACTGGCAGCAAGGATGATTGTCTTTAATACGATGGCCATGGGCCATGTTGGTATTTGCATTTTGCGCAGTACGAACCTACAACCTTGGGAAACCTTGGGATCCTCGTAGCAGAATAACTGCATCACCAAGTGCTCAGGAA

Full Affymetrix probeset data:

Annotations for 1638935_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime