FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638937_at:

>probe:Drosophila_2:1638937_at:242:481; Interrogation_Position=1775; Antisense; GTATCAGTTGAACTCGTACCTTAGT
>probe:Drosophila_2:1638937_at:329:91; Interrogation_Position=1801; Antisense; AGTTAACGCGACCACATGTATCCAT
>probe:Drosophila_2:1638937_at:210:59; Interrogation_Position=1816; Antisense; ATGTATCCATGTACTTATGTCTAAG
>probe:Drosophila_2:1638937_at:650:115; Interrogation_Position=1857; Antisense; AGCATTTTCCTTTGTGATCTAACAG
>probe:Drosophila_2:1638937_at:580:595; Interrogation_Position=1906; Antisense; TGTGAAATGTACACCACACGCCGCA
>probe:Drosophila_2:1638937_at:352:157; Interrogation_Position=1921; Antisense; ACACGCCGCACACAATATACGATGT
>probe:Drosophila_2:1638937_at:62:665; Interrogation_Position=1959; Antisense; TAAATTATAAGTCCTCGACCGCACC
>probe:Drosophila_2:1638937_at:549:243; Interrogation_Position=2005; Antisense; AATATTGCCTTAGTGTAGACCTCGT
>probe:Drosophila_2:1638937_at:636:485; Interrogation_Position=2019; Antisense; GTAGACCTCGTTTTGTATGTGTGAA
>probe:Drosophila_2:1638937_at:44:601; Interrogation_Position=2065; Antisense; TGTACTATGATGCATTTCACGGAAA
>probe:Drosophila_2:1638937_at:373:611; Interrogation_Position=2106; Antisense; TGAAAGTTTGCCCAACGTCGGCTTC
>probe:Drosophila_2:1638937_at:180:197; Interrogation_Position=2119; Antisense; AACGTCGGCTTCATTTTTGTATACT
>probe:Drosophila_2:1638937_at:479:679; Interrogation_Position=2138; Antisense; TATACTTTTTCTGAACTTTACCAAG
>probe:Drosophila_2:1638937_at:713:457; Interrogation_Position=2165; Antisense; GATAGTCAGATTTGTTTACCAATGT

Paste this into a BLAST search page for me
GTATCAGTTGAACTCGTACCTTAGTAGTTAACGCGACCACATGTATCCATATGTATCCATGTACTTATGTCTAAGAGCATTTTCCTTTGTGATCTAACAGTGTGAAATGTACACCACACGCCGCAACACGCCGCACACAATATACGATGTTAAATTATAAGTCCTCGACCGCACCAATATTGCCTTAGTGTAGACCTCGTGTAGACCTCGTTTTGTATGTGTGAATGTACTATGATGCATTTCACGGAAATGAAAGTTTGCCCAACGTCGGCTTCAACGTCGGCTTCATTTTTGTATACTTATACTTTTTCTGAACTTTACCAAGGATAGTCAGATTTGTTTACCAATGT

Full Affymetrix probeset data:

Annotations for 1638937_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720