FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638938_at:

>probe:Drosophila_2:1638938_at:42:379; Interrogation_Position=1011; Antisense; GAACCAACGCCTGGAGACCTATTTG
>probe:Drosophila_2:1638938_at:223:689; Interrogation_Position=1030; Antisense; TATTTGCGCGCCTTGCGCCAGAAAC
>probe:Drosophila_2:1638938_at:43:313; Interrogation_Position=1046; Antisense; GCCAGAAACTGGTCGCAGCTCTCGG
>probe:Drosophila_2:1638938_at:133:119; Interrogation_Position=1062; Antisense; AGCTCTCGGCGGAATCTCGATGCCA
>probe:Drosophila_2:1638938_at:242:251; Interrogation_Position=1097; Antisense; CAAGTGGTCCCAGCGTTGGCAACAT
>probe:Drosophila_2:1638938_at:412:611; Interrogation_Position=1122; Antisense; TGACAAGTACATCCGGCACTTAGCC
>probe:Drosophila_2:1638938_at:185:651; Interrogation_Position=1158; Antisense; TCAGCCAAGCAACGTCACTTTGATT
>probe:Drosophila_2:1638938_at:508:439; Interrogation_Position=1192; Antisense; GAGGCGCTGCGTAAAGTGGACACCA
>probe:Drosophila_2:1638938_at:525:221; Interrogation_Position=1205; Antisense; AAGTGGACACCAGTAGCTTGCTAAA
>probe:Drosophila_2:1638938_at:287:487; Interrogation_Position=1217; Antisense; GTAGCTTGCTAAAACCGTGATTCAT
>probe:Drosophila_2:1638938_at:517:23; Interrogation_Position=1351; Antisense; ATATCCGCAGCATTTGTATGTAGCC
>probe:Drosophila_2:1638938_at:509:429; Interrogation_Position=850; Antisense; GAGTTCATCGAACACAATCGCAGCA
>probe:Drosophila_2:1638938_at:102:121; Interrogation_Position=884; Antisense; AGCTGAGGACGCTGCGCAAGGCCAA
>probe:Drosophila_2:1638938_at:663:293; Interrogation_Position=959; Antisense; CGAAAGCCGGGTACGCCAAGGTGAT

Paste this into a BLAST search page for me
GAACCAACGCCTGGAGACCTATTTGTATTTGCGCGCCTTGCGCCAGAAACGCCAGAAACTGGTCGCAGCTCTCGGAGCTCTCGGCGGAATCTCGATGCCACAAGTGGTCCCAGCGTTGGCAACATTGACAAGTACATCCGGCACTTAGCCTCAGCCAAGCAACGTCACTTTGATTGAGGCGCTGCGTAAAGTGGACACCAAAGTGGACACCAGTAGCTTGCTAAAGTAGCTTGCTAAAACCGTGATTCATATATCCGCAGCATTTGTATGTAGCCGAGTTCATCGAACACAATCGCAGCAAGCTGAGGACGCTGCGCAAGGCCAACGAAAGCCGGGTACGCCAAGGTGAT

Full Affymetrix probeset data:

Annotations for 1638938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720