Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638939_at:

>probe:Drosophila_2:1638939_at:275:189; Interrogation_Position=1840; Antisense; AACATGGAGTGCGTACAAGTAGACA
>probe:Drosophila_2:1638939_at:385:207; Interrogation_Position=1914; Antisense; AAGCTTCTTACGTGCAATATGTGGT
>probe:Drosophila_2:1638939_at:292:91; Interrogation_Position=1952; Antisense; AGTATTCTTTAATCTCTAGTGCTAG
>probe:Drosophila_2:1638939_at:561:403; Interrogation_Position=1986; Antisense; GACTAGATTTGTTTCTTTACCCTCT
>probe:Drosophila_2:1638939_at:255:19; Interrogation_Position=1992; Antisense; ATTTGTTTCTTTACCCTCTACACAT
>probe:Drosophila_2:1638939_at:253:301; Interrogation_Position=2005; Antisense; CCCTCTACACATTCCTGACAGATAA
>probe:Drosophila_2:1638939_at:49:401; Interrogation_Position=2021; Antisense; GACAGATAAGTTGGTTATGCCATTT
>probe:Drosophila_2:1638939_at:142:313; Interrogation_Position=2039; Antisense; GCCATTTTTTAATCACTCCTCTTAT
>probe:Drosophila_2:1638939_at:584:699; Interrogation_Position=2069; Antisense; TTTTTACCTGAGATTAACGCCTGCA
>probe:Drosophila_2:1638939_at:250:661; Interrogation_Position=2083; Antisense; TAACGCCTGCAGTATTCCAGAAACT
>probe:Drosophila_2:1638939_at:342:257; Interrogation_Position=2134; Antisense; CAAATGTAATGTCGGTCTGTCTGTT
>probe:Drosophila_2:1638939_at:336:499; Interrogation_Position=2144; Antisense; GTCGGTCTGTCTGTTACATGTTAAG
>probe:Drosophila_2:1638939_at:66:705; Interrogation_Position=2213; Antisense; TTATAAAAAGGGTGGCGGCAGCAAC
>probe:Drosophila_2:1638939_at:34:575; Interrogation_Position=2226; Antisense; GGCGGCAGCAACATAGTGAAATCTA

Paste this into a BLAST search page for me
AACATGGAGTGCGTACAAGTAGACAAAGCTTCTTACGTGCAATATGTGGTAGTATTCTTTAATCTCTAGTGCTAGGACTAGATTTGTTTCTTTACCCTCTATTTGTTTCTTTACCCTCTACACATCCCTCTACACATTCCTGACAGATAAGACAGATAAGTTGGTTATGCCATTTGCCATTTTTTAATCACTCCTCTTATTTTTTACCTGAGATTAACGCCTGCATAACGCCTGCAGTATTCCAGAAACTCAAATGTAATGTCGGTCTGTCTGTTGTCGGTCTGTCTGTTACATGTTAAGTTATAAAAAGGGTGGCGGCAGCAACGGCGGCAGCAACATAGTGAAATCTA

Full Affymetrix probeset data:

Annotations for 1638939_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime