FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638940_at:

>probe:Drosophila_2:1638940_at:591:629; Interrogation_Position=4086; Antisense; TCCAGCATCTGGTACTGCTTGTACA
>probe:Drosophila_2:1638940_at:102:601; Interrogation_Position=4105; Antisense; TGTACAGGGACAACATCTTGCCGCC
>probe:Drosophila_2:1638940_at:87:301; Interrogation_Position=4126; Antisense; CGCCGGCGGAGATCATCATCAAGTA
>probe:Drosophila_2:1638940_at:33:37; Interrogation_Position=4140; Antisense; ATCATCAAGTAGAAGTGCCCTCTCC
>probe:Drosophila_2:1638940_at:516:643; Interrogation_Position=4160; Antisense; TCTCCCAGCTGCCAAACATAGATTT
>probe:Drosophila_2:1638940_at:12:151; Interrogation_Position=4175; Antisense; ACATAGATTTAACCGCCGTCTTGTG
>probe:Drosophila_2:1638940_at:202:319; Interrogation_Position=4189; Antisense; GCCGTCTTGTGCATTTTTCTGTAGA
>probe:Drosophila_2:1638940_at:386:217; Interrogation_Position=4406; Antisense; AAGTATATGCCCTTTGTCTTCAACA
>probe:Drosophila_2:1638940_at:640:599; Interrogation_Position=4420; Antisense; TGTCTTCAACATAGCTCGATATCTG
>probe:Drosophila_2:1638940_at:640:401; Interrogation_Position=4444; Antisense; GACATATCTAGTGTTTATCTACATA
>probe:Drosophila_2:1638940_at:158:15; Interrogation_Position=4493; Antisense; ATTAGTTAGGCACAGCCACACCGAG
>probe:Drosophila_2:1638940_at:529:295; Interrogation_Position=4514; Antisense; CGAGCAGCAAATTTTAGGCTAATTA
>probe:Drosophila_2:1638940_at:32:483; Interrogation_Position=4582; Antisense; GTATATGTTTCTAATTGGATTCGCA
>probe:Drosophila_2:1638940_at:170:543; Interrogation_Position=4598; Antisense; GGATTCGCATTTATTCAATGTTTGC

Paste this into a BLAST search page for me
TCCAGCATCTGGTACTGCTTGTACATGTACAGGGACAACATCTTGCCGCCCGCCGGCGGAGATCATCATCAAGTAATCATCAAGTAGAAGTGCCCTCTCCTCTCCCAGCTGCCAAACATAGATTTACATAGATTTAACCGCCGTCTTGTGGCCGTCTTGTGCATTTTTCTGTAGAAAGTATATGCCCTTTGTCTTCAACATGTCTTCAACATAGCTCGATATCTGGACATATCTAGTGTTTATCTACATAATTAGTTAGGCACAGCCACACCGAGCGAGCAGCAAATTTTAGGCTAATTAGTATATGTTTCTAATTGGATTCGCAGGATTCGCATTTATTCAATGTTTGC

Full Affymetrix probeset data:

Annotations for 1638940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720