FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638942_at:

>probe:Drosophila_2:1638942_at:598:581; Interrogation_Position=522; Antisense; TGGCCGATGCCGGTGTCAATCTCTA
>probe:Drosophila_2:1638942_at:399:201; Interrogation_Position=561; Antisense; AACCGGTGCAGGATGTCGTCAGAGT
>probe:Drosophila_2:1638942_at:437:61; Interrogation_Position=573; Antisense; ATGTCGTCAGAGTCAGTCGCCGAGT
>probe:Drosophila_2:1638942_at:704:125; Interrogation_Position=633; Antisense; AGCCGGGCACCGAGGTACAAGATCT
>probe:Drosophila_2:1638942_at:497:373; Interrogation_Position=661; Antisense; GAAGTACTTGAGCATTGCCGACGTT
>probe:Drosophila_2:1638942_at:77:625; Interrogation_Position=676; Antisense; TGCCGACGTTGTGCTGGTGATGACC
>probe:Drosophila_2:1638942_at:325:289; Interrogation_Position=718; Antisense; CGGACAATCCTTCATGGCCGATATG
>probe:Drosophila_2:1638942_at:729:303; Interrogation_Position=746; Antisense; CCGAAGGTCAAGTGGCTGCGCGAAA
>probe:Drosophila_2:1638942_at:634:593; Interrogation_Position=807; Antisense; TGGGACCCAAGACTATACACTGCTG
>probe:Drosophila_2:1638942_at:450:685; Interrogation_Position=820; Antisense; TATACACTGCTGTGCCGAGGCCGGA
>probe:Drosophila_2:1638942_at:564:439; Interrogation_Position=836; Antisense; GAGGCCGGAGCCAACATGATCGTCT
>probe:Drosophila_2:1638942_at:132:35; Interrogation_Position=888; Antisense; ATCAGTCGCAGGTCATCAAGGAGTT
>probe:Drosophila_2:1638942_at:38:443; Interrogation_Position=917; Antisense; GATGTGGTGCACAGCTACCTCAAAT
>probe:Drosophila_2:1638942_at:329:427; Interrogation_Position=943; Antisense; GAGATTCATTTACCAGCTAGCTTAA

Paste this into a BLAST search page for me
TGGCCGATGCCGGTGTCAATCTCTAAACCGGTGCAGGATGTCGTCAGAGTATGTCGTCAGAGTCAGTCGCCGAGTAGCCGGGCACCGAGGTACAAGATCTGAAGTACTTGAGCATTGCCGACGTTTGCCGACGTTGTGCTGGTGATGACCCGGACAATCCTTCATGGCCGATATGCCGAAGGTCAAGTGGCTGCGCGAAATGGGACCCAAGACTATACACTGCTGTATACACTGCTGTGCCGAGGCCGGAGAGGCCGGAGCCAACATGATCGTCTATCAGTCGCAGGTCATCAAGGAGTTGATGTGGTGCACAGCTACCTCAAATGAGATTCATTTACCAGCTAGCTTAA

Full Affymetrix probeset data:

Annotations for 1638942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720