FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638943_at:

>probe:Drosophila_2:1638943_at:561:385; Interrogation_Position=101; Antisense; GAAAACGCGAGTGCTACTCCCTGGA
>probe:Drosophila_2:1638943_at:128:341; Interrogation_Position=113; Antisense; GCTACTCCCTGGACAGCAAGAAGTA
>probe:Drosophila_2:1638943_at:695:61; Interrogation_Position=13; Antisense; ATGTCGTCGACAAATGAAACCAACC
>probe:Drosophila_2:1638943_at:125:211; Interrogation_Position=130; Antisense; AAGAAGTATTCCCTGGTACCAGCCA
>probe:Drosophila_2:1638943_at:666:307; Interrogation_Position=158; Antisense; CCAGCAGCTCAGGACACGGAAAGTT
>probe:Drosophila_2:1638943_at:323:255; Interrogation_Position=184; Antisense; CAAACCGAACTCAAAAAGCGCCGCA
>probe:Drosophila_2:1638943_at:558:253; Interrogation_Position=213; Antisense; CAAACTGAATCGCATGTACACTTAC
>probe:Drosophila_2:1638943_at:162:349; Interrogation_Position=224; Antisense; GCATGTACACTTACGAGGCTGATAA
>probe:Drosophila_2:1638943_at:657:29; Interrogation_Position=245; Antisense; ATAAGAATTTCATCAAGGCTCGCAA
>probe:Drosophila_2:1638943_at:555:221; Interrogation_Position=25; Antisense; AATGAAACCAACCAAGTGCTGCAGC
>probe:Drosophila_2:1638943_at:467:617; Interrogation_Position=44; Antisense; TGCAGCGCCTGAACAGCCTGAAAAT
>probe:Drosophila_2:1638943_at:515:259; Interrogation_Position=57; Antisense; CAGCCTGAAAATCGTGGAAACCCCA
>probe:Drosophila_2:1638943_at:459:289; Interrogation_Position=69; Antisense; CGTGGAAACCCCAAAGGAGCAGCAT
>probe:Drosophila_2:1638943_at:294:421; Interrogation_Position=85; Antisense; GAGCAGCATGAGTTCGGAAAACGCG

Paste this into a BLAST search page for me
GAAAACGCGAGTGCTACTCCCTGGAGCTACTCCCTGGACAGCAAGAAGTAATGTCGTCGACAAATGAAACCAACCAAGAAGTATTCCCTGGTACCAGCCACCAGCAGCTCAGGACACGGAAAGTTCAAACCGAACTCAAAAAGCGCCGCACAAACTGAATCGCATGTACACTTACGCATGTACACTTACGAGGCTGATAAATAAGAATTTCATCAAGGCTCGCAAAATGAAACCAACCAAGTGCTGCAGCTGCAGCGCCTGAACAGCCTGAAAATCAGCCTGAAAATCGTGGAAACCCCACGTGGAAACCCCAAAGGAGCAGCATGAGCAGCATGAGTTCGGAAAACGCG

Full Affymetrix probeset data:

Annotations for 1638943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720