Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638944_at:

>probe:Drosophila_2:1638944_at:536:613; Interrogation_Position=1346; Antisense; TGAAGAAGATCGCACAGCGCGCCAC
>probe:Drosophila_2:1638944_at:304:69; Interrogation_Position=1426; Antisense; ATGGCCAAGGGATGCATCGTCGAGA
>probe:Drosophila_2:1638944_at:642:229; Interrogation_Position=1450; Antisense; AATGTGCTGCGCGTGTTGCGTAGCC
>probe:Drosophila_2:1638944_at:451:457; Interrogation_Position=1477; Antisense; GATTCCGCGGGCACTGGCATGTTGC
>probe:Drosophila_2:1638944_at:570:583; Interrogation_Position=1491; Antisense; TGGCATGTTGCCCTACAGTCAGCTG
>probe:Drosophila_2:1638944_at:392:335; Interrogation_Position=1524; Antisense; GCTGACCACCATGGGCAATCGATTG
>probe:Drosophila_2:1638944_at:615:43; Interrogation_Position=1577; Antisense; ATCGCGCTGCGGACATTAATGGCAA
>probe:Drosophila_2:1638944_at:226:657; Interrogation_Position=1593; Antisense; TAATGGCAATGTCCTCTACGAGCAC
>probe:Drosophila_2:1638944_at:717:671; Interrogation_Position=1609; Antisense; TACGAGCACCTAGTACACCAGCTGT
>probe:Drosophila_2:1638944_at:217:189; Interrogation_Position=1667; Antisense; AACAGGCGCAGCTTTACCTGCAGGC
>probe:Drosophila_2:1638944_at:510:429; Interrogation_Position=1735; Antisense; GAGTTCATCGATGCCATCCGGCGGG
>probe:Drosophila_2:1638944_at:463:335; Interrogation_Position=1800; Antisense; GCTCGAGCTGCTCAATCGCAATGGG
>probe:Drosophila_2:1638944_at:560:525; Interrogation_Position=1890; Antisense; GGGCATCAACTATTGTCGCTTCCTG
>probe:Drosophila_2:1638944_at:97:503; Interrogation_Position=1904; Antisense; GTCGCTTCCTGGAGTTCATTATGAA

Paste this into a BLAST search page for me
TGAAGAAGATCGCACAGCGCGCCACATGGCCAAGGGATGCATCGTCGAGAAATGTGCTGCGCGTGTTGCGTAGCCGATTCCGCGGGCACTGGCATGTTGCTGGCATGTTGCCCTACAGTCAGCTGGCTGACCACCATGGGCAATCGATTGATCGCGCTGCGGACATTAATGGCAATAATGGCAATGTCCTCTACGAGCACTACGAGCACCTAGTACACCAGCTGTAACAGGCGCAGCTTTACCTGCAGGCGAGTTCATCGATGCCATCCGGCGGGGCTCGAGCTGCTCAATCGCAATGGGGGGCATCAACTATTGTCGCTTCCTGGTCGCTTCCTGGAGTTCATTATGAA

Full Affymetrix probeset data:

Annotations for 1638944_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime