Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638947_at:

>probe:Drosophila_2:1638947_at:103:75; Interrogation_Position=319; Antisense; AGGACTGGAGCTTTTTCCGCGGCGA
>probe:Drosophila_2:1638947_at:381:449; Interrogation_Position=342; Antisense; GATCGTATCGAAGTCCTTGTGGGTA
>probe:Drosophila_2:1638947_at:545:269; Interrogation_Position=385; Antisense; GAATTGTCACCCAGGTTATACCCGA
>probe:Drosophila_2:1638947_at:83:361; Interrogation_Position=437; Antisense; GAACTGGCACTATCGCAAGGTTGGC
>probe:Drosophila_2:1638947_at:660:427; Interrogation_Position=471; Antisense; GAGTTTCCCGGTATCATTATCAAGT
>probe:Drosophila_2:1638947_at:684:15; Interrogation_Position=486; Antisense; ATTATCAAGTCCGAGGCACCTTTGC
>probe:Drosophila_2:1638947_at:424:693; Interrogation_Position=506; Antisense; TTTGCACGTCACCAAGGACATTCGT
>probe:Drosophila_2:1638947_at:489:149; Interrogation_Position=523; Antisense; ACATTCGTCTGGTTGACCCATCGGA
>probe:Drosophila_2:1638947_at:164:451; Interrogation_Position=546; Antisense; GATCTTCAGGGCACCGACTTTGAGT
>probe:Drosophila_2:1638947_at:531:105; Interrogation_Position=592; Antisense; AGAAAGTGCGGGTGTCCTTGCGATC
>probe:Drosophila_2:1638947_at:3:425; Interrogation_Position=639; Antisense; GAGACGAACAACCAGACGCACGATT
>probe:Drosophila_2:1638947_at:108:467; Interrogation_Position=714; Antisense; GTTGTGGGCGAGATCACCTTTCAGC
>probe:Drosophila_2:1638947_at:114:125; Interrogation_Position=736; Antisense; AGCCCAAGTTGTCCACATTCGAGAT
>probe:Drosophila_2:1638947_at:217:381; Interrogation_Position=792; Antisense; GAACGCACGCCAGTCAAGAGCTATT

Paste this into a BLAST search page for me
AGGACTGGAGCTTTTTCCGCGGCGAGATCGTATCGAAGTCCTTGTGGGTAGAATTGTCACCCAGGTTATACCCGAGAACTGGCACTATCGCAAGGTTGGCGAGTTTCCCGGTATCATTATCAAGTATTATCAAGTCCGAGGCACCTTTGCTTTGCACGTCACCAAGGACATTCGTACATTCGTCTGGTTGACCCATCGGAGATCTTCAGGGCACCGACTTTGAGTAGAAAGTGCGGGTGTCCTTGCGATCGAGACGAACAACCAGACGCACGATTGTTGTGGGCGAGATCACCTTTCAGCAGCCCAAGTTGTCCACATTCGAGATGAACGCACGCCAGTCAAGAGCTATT

Full Affymetrix probeset data:

Annotations for 1638947_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime