FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638954_at:

>probe:Drosophila_2:1638954_at:22:393; Interrogation_Position=1067; Antisense; GAAATGGCCACGTTTCTATTTTTCA
>probe:Drosophila_2:1638954_at:15:643; Interrogation_Position=1081; Antisense; TCTATTTTTCATCCGGCAATACCGG
>probe:Drosophila_2:1638954_at:223:215; Interrogation_Position=610; Antisense; AAGATGGTGCTCAGTCGTCCGCATG
>probe:Drosophila_2:1638954_at:621:49; Interrogation_Position=632; Antisense; ATGCCCAGGGACATGGTCACGGACA
>probe:Drosophila_2:1638954_at:687:557; Interrogation_Position=682; Antisense; GGACATGCACATGGACACGGCTATT
>probe:Drosophila_2:1638954_at:575:367; Interrogation_Position=708; Antisense; GAAGGACGACGATCCGCGAAAGTTC
>probe:Drosophila_2:1638954_at:497:111; Interrogation_Position=766; Antisense; AGCACATCGATTTTGTTCCTGGTCT
>probe:Drosophila_2:1638954_at:637:439; Interrogation_Position=801; Antisense; GATGGCCATTCTCCACATGACGATC
>probe:Drosophila_2:1638954_at:387:55; Interrogation_Position=817; Antisense; ATGACGATCGCCTCGGAGGTCTATC
>probe:Drosophila_2:1638954_at:473:467; Interrogation_Position=888; Antisense; GTTGATTAACTACTCGCTGACCTTC
>probe:Drosophila_2:1638954_at:290:39; Interrogation_Position=916; Antisense; ATCTACTGCCTGTTCAGCGAGGATT
>probe:Drosophila_2:1638954_at:663:435; Interrogation_Position=934; Antisense; GAGGATTTCCGCAACACCCTGGTGA
>probe:Drosophila_2:1638954_at:269:557; Interrogation_Position=959; Antisense; GGACGATCAAGTGGCCCTGGTTGAA
>probe:Drosophila_2:1638954_at:61:613; Interrogation_Position=980; Antisense; TGAAGGGCAAGTTCTGCCACCAGGC

Paste this into a BLAST search page for me
GAAATGGCCACGTTTCTATTTTTCATCTATTTTTCATCCGGCAATACCGGAAGATGGTGCTCAGTCGTCCGCATGATGCCCAGGGACATGGTCACGGACAGGACATGCACATGGACACGGCTATTGAAGGACGACGATCCGCGAAAGTTCAGCACATCGATTTTGTTCCTGGTCTGATGGCCATTCTCCACATGACGATCATGACGATCGCCTCGGAGGTCTATCGTTGATTAACTACTCGCTGACCTTCATCTACTGCCTGTTCAGCGAGGATTGAGGATTTCCGCAACACCCTGGTGAGGACGATCAAGTGGCCCTGGTTGAATGAAGGGCAAGTTCTGCCACCAGGC

Full Affymetrix probeset data:

Annotations for 1638954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720