FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638955_at:

>probe:Drosophila_2:1638955_at:402:407; Interrogation_Position=224; Antisense; GACGATATCAACAGGTCCGGGATTT
>probe:Drosophila_2:1638955_at:439:543; Interrogation_Position=243; Antisense; GGATTTGACCGTACATGCCCAACAA
>probe:Drosophila_2:1638955_at:447:539; Interrogation_Position=314; Antisense; GGTATGTCGGCCTATCACCAAACTA
>probe:Drosophila_2:1638955_at:91:179; Interrogation_Position=333; Antisense; AAACTACTGCGCTCAACGCGGATTG
>probe:Drosophila_2:1638955_at:429:3; Interrogation_Position=354; Antisense; ATTGGACTCCGACTTGGCGGTGATC
>probe:Drosophila_2:1638955_at:88:607; Interrogation_Position=374; Antisense; TGATCCGTTTGAGTCGTCCCTTTGA
>probe:Drosophila_2:1638955_at:660:379; Interrogation_Position=507; Antisense; GAACCAGTGTTTGCAGGAGGCCAAC
>probe:Drosophila_2:1638955_at:28:199; Interrogation_Position=529; Antisense; AACGTTAAGCTCATCTCGCACAGGG
>probe:Drosophila_2:1638955_at:670:159; Interrogation_Position=596; Antisense; ACAACATGTTTTGTGCTCTGGGCAA
>probe:Drosophila_2:1638955_at:509:591; Interrogation_Position=672; Antisense; TGGTCGCTCCGTGGGCATAGTATCG
>probe:Drosophila_2:1638955_at:289:569; Interrogation_Position=712; Antisense; GGCAGTGGTTATCCAGGCGTCTACA
>probe:Drosophila_2:1638955_at:156:317; Interrogation_Position=740; Antisense; GCCTCAGTAGTCCATCGATTACGTA
>probe:Drosophila_2:1638955_at:244:7; Interrogation_Position=757; Antisense; ATTACGTACTGGCTGAAGGACTTTA
>probe:Drosophila_2:1638955_at:10:557; Interrogation_Position=774; Antisense; GGACTTTATCGAGCGACATTGCTAA

Paste this into a BLAST search page for me
GACGATATCAACAGGTCCGGGATTTGGATTTGACCGTACATGCCCAACAAGGTATGTCGGCCTATCACCAAACTAAAACTACTGCGCTCAACGCGGATTGATTGGACTCCGACTTGGCGGTGATCTGATCCGTTTGAGTCGTCCCTTTGAGAACCAGTGTTTGCAGGAGGCCAACAACGTTAAGCTCATCTCGCACAGGGACAACATGTTTTGTGCTCTGGGCAATGGTCGCTCCGTGGGCATAGTATCGGGCAGTGGTTATCCAGGCGTCTACAGCCTCAGTAGTCCATCGATTACGTAATTACGTACTGGCTGAAGGACTTTAGGACTTTATCGAGCGACATTGCTAA

Full Affymetrix probeset data:

Annotations for 1638955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720