Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638956_at:

>probe:Drosophila_2:1638956_at:661:373; Interrogation_Position=2625; Antisense; GAAGACGACACGAGGTGAGTCCGAT
>probe:Drosophila_2:1638956_at:572:293; Interrogation_Position=2635; Antisense; CGAGGTGAGTCCGATTCAGCTAATA
>probe:Drosophila_2:1638956_at:34:651; Interrogation_Position=2650; Antisense; TCAGCTAATAACAATCTCGGCACGT
>probe:Drosophila_2:1638956_at:81:663; Interrogation_Position=2658; Antisense; TAACAATCTCGGCACGTTGCTCTAT
>probe:Drosophila_2:1638956_at:381:293; Interrogation_Position=2672; Antisense; CGTTGCTCTATTCGGCCGGATTTAA
>probe:Drosophila_2:1638956_at:492:459; Interrogation_Position=2690; Antisense; GATTTAATTCCGGTGTCGGTGCGCT
>probe:Drosophila_2:1638956_at:579:535; Interrogation_Position=2707; Antisense; GGTGCGCTACACAAACGACTGTTCA
>probe:Drosophila_2:1638956_at:539:157; Interrogation_Position=2717; Antisense; ACAAACGACTGTTCACAACAACAAC
>probe:Drosophila_2:1638956_at:627:157; Interrogation_Position=2767; Antisense; ACAATCACATCGATAACAACAGCAA
>probe:Drosophila_2:1638956_at:37:159; Interrogation_Position=2791; Antisense; ACAACAACAATCATTACGCTGGCCA
>probe:Drosophila_2:1638956_at:107:709; Interrogation_Position=2804; Antisense; TTACGCTGGCCACCACAATAAGCAT
>probe:Drosophila_2:1638956_at:694:579; Interrogation_Position=2811; Antisense; GGCCACCACAATAAGCATAACATTA
>probe:Drosophila_2:1638956_at:393:191; Interrogation_Position=2829; Antisense; AACATTACTTAGTGTCCTAGCCTCA
>probe:Drosophila_2:1638956_at:331:597; Interrogation_Position=2841; Antisense; TGTCCTAGCCTCAATGTTAGCCTAA

Paste this into a BLAST search page for me
GAAGACGACACGAGGTGAGTCCGATCGAGGTGAGTCCGATTCAGCTAATATCAGCTAATAACAATCTCGGCACGTTAACAATCTCGGCACGTTGCTCTATCGTTGCTCTATTCGGCCGGATTTAAGATTTAATTCCGGTGTCGGTGCGCTGGTGCGCTACACAAACGACTGTTCAACAAACGACTGTTCACAACAACAACACAATCACATCGATAACAACAGCAAACAACAACAATCATTACGCTGGCCATTACGCTGGCCACCACAATAAGCATGGCCACCACAATAAGCATAACATTAAACATTACTTAGTGTCCTAGCCTCATGTCCTAGCCTCAATGTTAGCCTAA

Full Affymetrix probeset data:

Annotations for 1638956_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime