Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638958_at:

>probe:Drosophila_2:1638958_at:30:259; Interrogation_Position=118; Antisense; CACTTCTTTTCTACACTTTACACAA
>probe:Drosophila_2:1638958_at:14:699; Interrogation_Position=134; Antisense; TTTACACAACAATCCGCGCAAGAGG
>probe:Drosophila_2:1638958_at:521:371; Interrogation_Position=158; Antisense; GAAGTACAGGAACTTTTACTCCACT
>probe:Drosophila_2:1638958_at:183:709; Interrogation_Position=173; Antisense; TTACTCCACTTACGATCCCATGGAT
>probe:Drosophila_2:1638958_at:330:307; Interrogation_Position=190; Antisense; CCATGGATGCGTTCGACCGCATGAT
>probe:Drosophila_2:1638958_at:127:85; Interrogation_Position=216; Antisense; AGTGGAGGATACCTATCGTCCTGTC
>probe:Drosophila_2:1638958_at:586:377; Interrogation_Position=237; Antisense; TGTCCTCCGGGCAGTGGTCCCAAAA
>probe:Drosophila_2:1638958_at:271:401; Interrogation_Position=296; Antisense; GACAGTATCTTATCTCAATTCCCAT
>probe:Drosophila_2:1638958_at:287:161; Interrogation_Position=32; Antisense; AAAGTTTAAGTTTCCCATGCATGAC
>probe:Drosophila_2:1638958_at:561:707; Interrogation_Position=340; Antisense; TTAACCATGTAACCCCTTGTCGACA
>probe:Drosophila_2:1638958_at:308:723; Interrogation_Position=356; Antisense; TTGTCGACACACCTCCTAAATGGAA
>probe:Drosophila_2:1638958_at:562:479; Interrogation_Position=41; Antisense; GTTTCCCATGCATGACTTACACTTG
>probe:Drosophila_2:1638958_at:4:667; Interrogation_Position=58; Antisense; TACACTTGAAGCAAACGTTTCGCAA
>probe:Drosophila_2:1638958_at:260:181; Interrogation_Position=86; Antisense; AAAAATGGCCTGCACTTTGGCCCTG

Paste this into a BLAST search page for me
CACTTCTTTTCTACACTTTACACAATTTACACAACAATCCGCGCAAGAGGGAAGTACAGGAACTTTTACTCCACTTTACTCCACTTACGATCCCATGGATCCATGGATGCGTTCGACCGCATGATAGTGGAGGATACCTATCGTCCTGTCTGTCCTCCGGGCAGTGGTCCCAAAAGACAGTATCTTATCTCAATTCCCATAAAGTTTAAGTTTCCCATGCATGACTTAACCATGTAACCCCTTGTCGACATTGTCGACACACCTCCTAAATGGAAGTTTCCCATGCATGACTTACACTTGTACACTTGAAGCAAACGTTTCGCAAAAAAATGGCCTGCACTTTGGCCCTG

Full Affymetrix probeset data:

Annotations for 1638958_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime