FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638959_at:

>probe:Drosophila_2:1638959_at:590:39; Interrogation_Position=314; Antisense; ATCTGAGCTTCCACTACGGATCTGT
>probe:Drosophila_2:1638959_at:382:141; Interrogation_Position=329; Antisense; ACGGATCTGTATGGTCTGGCTGGTC
>probe:Drosophila_2:1638959_at:574:145; Interrogation_Position=377; Antisense; ACTCCGGTGCTACGAGTGTGTCGAT
>probe:Drosophila_2:1638959_at:401:105; Interrogation_Position=406; Antisense; AGACGTCGTGCGGATCTGCTGATAA
>probe:Drosophila_2:1638959_at:585:451; Interrogation_Position=418; Antisense; GATCTGCTGATAATTCGCCGGGAAG
>probe:Drosophila_2:1638959_at:114:423; Interrogation_Position=448; Antisense; GAGAATGCCCGAACTCAACCATGTG
>probe:Drosophila_2:1638959_at:625:349; Interrogation_Position=542; Antisense; GCAGGTGGATCATTACTTTGACTAT
>probe:Drosophila_2:1638959_at:643:143; Interrogation_Position=596; Antisense; ACTGATGGACTTACCGGAGGGCTGC
>probe:Drosophila_2:1638959_at:457:361; Interrogation_Position=641; Antisense; GAATTGCAACTGTCGCGGAGAACTT
>probe:Drosophila_2:1638959_at:471:1; Interrogation_Position=677; Antisense; AAGTCATTCGACACCAAATTTCCGG
>probe:Drosophila_2:1638959_at:493:139; Interrogation_Position=692; Antisense; AAATTTCCGGTTGCCGTTCGTGCTG
>probe:Drosophila_2:1638959_at:326:471; Interrogation_Position=707; Antisense; GTTCGTGCTGATCTTATTGGCCCTG
>probe:Drosophila_2:1638959_at:282:691; Interrogation_Position=721; Antisense; TATTGGCCCTGGTCTGCGGCAAAAT
>probe:Drosophila_2:1638959_at:695:561; Interrogation_Position=807; Antisense; GGAACTCTCTAAGGCCACAAATATA

Paste this into a BLAST search page for me
ATCTGAGCTTCCACTACGGATCTGTACGGATCTGTATGGTCTGGCTGGTCACTCCGGTGCTACGAGTGTGTCGATAGACGTCGTGCGGATCTGCTGATAAGATCTGCTGATAATTCGCCGGGAAGGAGAATGCCCGAACTCAACCATGTGGCAGGTGGATCATTACTTTGACTATACTGATGGACTTACCGGAGGGCTGCGAATTGCAACTGTCGCGGAGAACTTAAGTCATTCGACACCAAATTTCCGGAAATTTCCGGTTGCCGTTCGTGCTGGTTCGTGCTGATCTTATTGGCCCTGTATTGGCCCTGGTCTGCGGCAAAATGGAACTCTCTAAGGCCACAAATATA

Full Affymetrix probeset data:

Annotations for 1638959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720